Skip to main content
NCBI home page
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2016 May 31;113(24):6731–6736. doi: 10.1073/pnas.1601537113

Oncogenic mutations in the FBXW7 gene of adult T-cell leukemia patients

Chien-Hung Yeh a, V体育安卓版 - Marcia Bellon a, Joanna Pancewicz-Wojtkiewicz a, Christophe Nicot a,1
PMCID: PMC4914202  PMID: 27247421

Significance

This study, to our knowledge for the first time, describes cooperative oncogenic activities of mutated F-box and WD repeat domain containing 7 (FBXW7; D510E and D527G) with the viral oncogene human T-cell leukemia virus type 1 Tax, mutated p53, or c-Myc. Given the high rate of mutation of both p53 and c-Myc in human cancers, our study suggests that the selective loss of FBXW7 functions may play a more active role than previously thought in tumorigenesis VSports注册入口.

Keywords: HTLV, FBXW7, Notch, leukemia, oncogene

Abstract

Human T-cell leukemia virus type 1 (HTLV-I) is associated with adult T-cell leukemia (ATL), an aggressive lymphoproliferative disease with a dismal prognosis. We have previously described the presence of Notch1 activating mutations and constitutive Notch1 signaling in patients with acute ATL. In this study, we report a high frequency of F-box and WD repeat domain containing 7 (FBXW7)/hCDC4 mutations within the WD40 substrate-binding domain in 8 of 32 acute ATL patients (25%). Functionally, ATL FBXW7 mutants lost their ability to interact with intracellular Notch (NICD), resulting in increased protein stability and constitutive Notch1 signaling. Consistent with the loss-of-function found in ATL patients, expression of WT FBXW7 in several patient-derived ATL lines demonstrated strong tumor-suppressor activity characterized by reduced proliferation of ATL cells. Remarkably, two FBXW7 mutants, D510E and D527G, demonstrated oncogenic activity when expressed in the presence of HTLV-I Tax, mutated p53 R276H, or c-Myc F138C found in human cancers. Transforming activity was further demonstrated by the ability of the FBXW7 D510E mutant to provide IL-2–independent growth of Tax-immortalized human T cells and increase the tumor formation in a xenograft mouse model of ATL. This study suggests that FBXW7, normally a tumor suppressor, can act as an oncogene when mutated and may play an important role in the pathogenesis of ATL V体育官网入口.

Human T-cell leukemia virus type 1 (HTLV-I)–associated adult T-cell leukemia (ATL) carries a dismal prognosis and limited treatment options (1). Although the molecular events leading to T-cell transformation are not fully elucidated, the low incidence and long latency of HTLV-I–associated ATL suggest that acquisition of genetic defects in virally infected cells are required for cellular transformation, and profound epigenetic changes have been reported in ATL cells (2). Although the viral Tax protein has a low transforming efficiency in human T cells, Tax plays a major role by altering signaling pathways, such as NF-κB, p53, and telomerase (3–5). In addition, Tax expression impairs DNA replication forks, increases DNA breaks, and simultaneously inhibits faithful repair through homologous recombination (6, 7). We have previously reported that HTLV-I–transformed ATL cells frequently display constitutive activation of the Notch signaling pathway and activating mutations within the proline, glutamic acid, serine, and threonine (PEST) domain of Notch1 (8). Constitutive activation of Notch signaling is relevant to ATL and its inhibition reduced proliferation and survival of ATL cells in vitro and significantly reduced tumors in an engrafted ATL mouse model (8). Because most mutations found in Notch disrupted F-box and WD repeat domain containing 7 (FBXW7)-mediated ubiquitination, degradation, and turnover of intracellular Notch (NICD), we hypothesized the presence of mutations in the FBXW7 gene in ATL patient samples. FBXW7 (also known as Sel-10, hCdc4, or hAgo) is a component of a S-phase kinase-associated protein 1 (Skp1)-Cul1-F-box protein ubiquitin ligase complex that regulates the degradation of Notch, cyclin E, c-Myc, mammalian target of rapamycin, myeloid cell leukemia 1 (Mcl-1), and c-Jun, most of which possess oncogenic functions (9, 10) VSports在线直播. Loss of FBXW7 by means of mutation or deletion has been reported in various human cancers and has been linked to severe chromosomal instability (11). In addition, inactivation of FBXW7 by miR-223 (12), a microRNA deregulated in ATL, has also been reported (13). Importantly, several studies have demonstrated that mutations in FBXW7 have clinical significance and can provide resistance to γ-secretase inhibitors (GSI) (14).

In this study, we report a high frequency of FBXW7 mutations in primary acute ATL patients, 8 of 32 (25%). The biological significance of these mutations is suggested by the fact that these mutations were generally associated with an increase in Notch1 signaling. Although WT FBXW7 acted as a tumor suppressor in ATL cells, we identified two FBXW7 mutants, D510E and G527G, with transforming activities when expressed along with another oncogene, such as Tax, p53, or c-Myc. To our knowledge this is the first example of FBXW7 mutants with oncogenic properties V体育2025版.

Results

FBXW7 Inhibits the Proliferation of ATL Cells.

Disruption of FBXW7 has been reported in various human cancers, and because FBXW7 can target many proteins involved in proliferation and survival for degradation, it has been classified as a tumor suppressor. However, its role in HTLV-I–transformed ATL cells has never been investigated. Generally ATL-transformed cell lines demonstrated significantly reduced mRNA expression levels of FBXW7 compared with normal peripheral blood mononuclear cells (PBMCs) (Fig. 1A). In contrast, freshly isolated uncultured ATL samples display variable levels of FBXW7 mRNA and about one-third of samples had reduced FBXW7 mRNA expression (Fig. 1A) VSports. To study the function of FBXW7 in ATL cells, we used lentiviral delivery and puromycin selection to generate stable Tet-inducible FBXW7-expressing cells. Four distinct patient-derived ATL lines (MT1, ATL-T, ATL-25, and ATL-43T) were used to investigate the effects of FBXW7 expression in ATL cells. Induction with doxycycline resulted in re-expression of FBXW7 (Fig. 1B). FBXW7-transduced lines and matched-control cell lines were treated with the same dose of doxycycline and cellular proliferation was measured by cell counts every other day for 10 d. Our results demonstrate that restoring expression of FBXW7 resulted in inhibition of ATL cell proliferation (Fig. 1B). These data suggest that FBXW7 exerts a tumor-suppressive effect in HTLV-I–transformed ATL cells.

Fig. 1.

Fig. 1.

Open in a new tab

FBXW7 is a tumor suppressor in ATL cells. The expression of FBXW7 in ATL-transformed cell lines and normal PBMCs (A) or healthy donors and freshly isolated ATL samples were evaluated by real-time RT-PCR. The arrow indicates the patients carrying the D510E mutation. (B) Cellular proliferation of FBXW7 transduced ATL lines were evaluated by cell count after reexpression of FBXW7. The data were from two independent experiments and shown as the average with SD. Western blot showed the expression of FBXW7. Actin served as a loading control. (C) The localizations of FBXW7 mutations found in primary ATL samples (Table 1) are highlighted in yellow on the FBXW7 protein 3D structure. (D) Transcriptional activities of NICD in cells expressing FBXW7 or FBXW7 mutants were measured by CSL-luciferase reporter assay. Luciferase activities were normalized to the CSL-luciferase reporter vector alone. The data are from two independent experiments and are shown as the average with SD. Western blot showed the expression of tagged-FBXW7 and mutants. (E) Dimer formation between FBXW7 and mutant W425R was analyzed in 293T cells transfected with Myc-tagged FBXW7 and Flag-tagged W425R. IP FBXW7 and Western blot W425R showed the dimerization. NICD expression in 293T cells transfected with NICD, FBXW7 WT and a dose increase of W425R were analyzed by Western blot (Lower). Dox, doxycycline.

FBXW7 Mutations in Patients with Acute ATL.

With the exception of T-cell acute lymphocytic leukemia (T-ALL), the mutation of FBXW7 is usually rare in human leukemia. T-ALL mutations in FBXW7 are predominantly located at arginine residues R479Q, R505C, and R465H and result in FBXW7 mutants unable to bind to or degrade targets (14). We sequenced FBXW7 in a cohort of 32 acute ATL samples of Caribbean origin previously characterized for the presence of Notch1 mutations (Table 1). Our results revealed mutation of the FBXW7 gene in 8 of 32 acute ATL patients. The mutations were located in the propeller domain in proximity to the pocket for substrate binding (Fig. 1C). Remarkably, 4 of 32 (12.5%) ATL patients with mutations in FBXW7 also carried a mutation in the NICD PEST domain (8). This observation is interesting because previous studies in T-ALL have shown that the combined effect of mutation in both NICD and FBXW7 improves a patient’s prognosis (15). We also sequenced the WD40 domain of FBXW7 from HTLV-I–transformed cells MT-2, MT-4, and C8166, and from ATL-derived cell lines but found no mutations. We next investigated the biological consequences of FBXW7 mutations. To this end, we used a transient assay in which FBXW7 WT or FBXW7 mutants are expressed along with NICD and a CSL [CBF-1, Su(H), LAG-1]-luciferase reporter construct (Fig. 1D). In this assay expression of NICD activates the CSL-Luc vector leading to higher luciferase values. However, when WT FBXW7 is coexpressed it targets NICD for degradation, lowering luciferase activation. The FBXW7 mutant R505C was used as a negative control. Our experiments demonstrated that six of eight FBXW7 mutations detected in ATL tumor cells resulted in a complete loss-of-function as demonstrated by luciferase activity similar to that of the R505C mutant (Fig. 1D). Two FBXW7 mutants, T416A and W406R, were partially inactive (Fig. 1D). Some FBXW7 mutants (H468R, S462P, and W425R) had higher activity, suggesting a dominant-negative effect (Fig. 1D). Because FBXW7 dimerization is essential for stable interaction with its substrates, we then tested if the above-mentioned mutants can dimerize with and antagonize WT FBXW7. In fact, dimer formation between FBXW7 and mutant W425R were readily observed upon coexpression in transient assays (Fig. 1E). Furthermore, a dose increase of W425R was able to completely block WT FBXW7-mediated degradation of NICD, confirming its dominant-negative effect (Fig. 1E).

Table 1.

Samples from 32 ATL patients were analyzed for mutations in the substrate binding domain (WD40 domains) of FBXW7 and compared with previously identified Notch1 mutations in the same acute ATL patient samples (8)

Patients NICD-PEST domain FBXW7
ATL 1 No mutation No mutation
ATL 2 No mutation No mutation
ATL 3 No mutation S462P
ATL 4 No mutation W425R
ATL 5 Q2546R No mutation
ATL 6 No mutation No mutation
ATL 7 G2427S No mutation
ATL 8 aa 2440-TAG L443F
ATL 9 No mutation No mutation
ATL 10 G2430A No mutation
ATL 11 S2470P H468R
ATL 12 No mutation No mutation
ATL 13 No mutation No mutation
ATL 14 No mutation D510E
ATL 15 No mutation No mutation
ATL 16 No mutation No mutation
ATL 17 P2465S No mutation
ATL 18 No mutation No mutation
ATL 19 No mutation No mutation
ATL 20 No mutation No mutation
ATL 21 aa 2403-TAG T416A
ATL 22 No mutation No mutation
ATL 23 aa 2466-TAG No mutation
ATL 24 No mutation No mutation
ATL 25 No mutation No mutation
ATL 26 V2380A D527G
ATL 27 S2423L No mutation
ATL 28 No mutation No mutation
ATL 29 No mutation No mutation
ATL 30 No mutation No mutation
ATL 31 No mutation W406R
ATL 32 No mutation No mutation
Open in a new tab

The boldface text presents the mutations and where they lie.

"V体育2025版" ATL FBXW7 Mutants Activate the Notch Signaling Pathway.

To confirm that FBXW7 mutants stimulate Notch1 signaling in human T cells, an ATL-transformed MT1 cell line, carrying WT FBXW7, was used to generate stable Tet-inducible cell lines expressing WT or FBXW7 mutants W425R, S462P, and D510E. Induction and expression of WT and mutant FBXW7 proteins were confirmed upon the addition of doxycycline to the media (Fig. 2A). The ability of WT FBXW7 but not mutants W425R, S462P, and D510E to degrade endogenous NICD in the context of ATL cells was also demonstrated by Western blot (Fig. 2B). Activation of the Notch signaling pathway was confirmed by increased expression of the target gene, hes family bHLH transcription factor 1 (Hes1), in cells carrying W425R, S462P, and D510E compared with WT (Fig. 2B). To further demonstrate activation of Notch1 in cells with mutated FBXW7, we next investigated the presence of NICD onto the Hes1 promoter by chromatin immunoprecipitation (ChIP). To demonstrate specificity, we first treated MT1 cells with GSI compound E, resulting in loss of NICD expression as shown by Western blot (Fig. 2C). This result was accompanied by a 70% decrease in the amount of NICD bound to the Hes1 promoter as determined by ChIP (Fig. 2C). Finally, the PCR product amplified by ChIP was cloned and sequenced to confirm the identity of the Hes1 promoter. Consistent with the data described above and the reduced degradation of NICD by FBXW7 mutants (Fig. 1D), we confirmed an increase in NICD promoter occupancy of the Hes1 gene by ChIP in cells carrying mutated FBXW7 W425R, S462P, and D510E compared with WT (Fig. 2D). Together, these results suggest that FBXW7 mutations acquired in ATL cells increase Notch1 signaling.

Fig. 2.

Fig. 2.

Open in a new tab

FBXW7 mutants activate the Notch signaling pathway. (A and B) RT-PCR for expression of FBXW7 and Hes1 after 48 h of doxycycline (Dox) induction in MT1 stable lines. Results were repeated at least twice and fold-change was calculated compared with GAPDH expression. Western blots confirm the induction of FBXW7 (A) and reduction of endogenous nuclear NICD in WT-expressing cells but not mutants of FBXW7 (B). Actin and cyclin A served as loading control. (C and D) ChIP assays on FBXW7 WT and mutant following induction in stably transduced MT1 lines using RT-PCR. ChIP assays were prepared using anti-Notch and amplified with Hes-1 specific primers. (C) MT1 cells cultured with or without GSI (1 µM for 72 h) served as an assay control for loss of NICD-Val1744 and Hes1 binding. Fold-change was calculated as a percent of the initial input material. Sequencing of the amplified product verified Hes1 amplification.

ATL FBXW7 Mutants Demonstrate Reduced Binding and Ubiquitin-Mediated Degradation of NICD.

We next investigated the ability of FBXW7 mutants to interact with NICD and promote ubiquitin-mediated turnover of NICD. FBXW7 and FBXW7 mutants were coexpressed along with NICD in 293T cells. Consistent with the reporter assay described in Fig.1D, our results showed that only FBXW7 mutants T416A and W406R retained their ability to degrade NICD (Fig. 3A). Accordingly, the half-life of NICD was extended in the presence of the FBXW7 ATL mutants (Fig. 3B). As expected from these data, most FBXW7 mutants found in ATL patients lost the ability to interact with NICD, and the FBXW7 mutants T416A and W406R retained binding (Fig. 3C). Surprisingly, despite the lack of NICD degradation, FBXW7 mutant D510E was still able to interact with NICD to a similar extent as the WT FBXW7 (Fig. 3C). The lack of NICD degradation was not a result of a defect in the ability of D510E to recruit SKP1 (Fig. 3D). We think that a conformational change of D510E may affect ubiquitination. FBXW7-mediated ubiquitination of NICD on Lysine K63 was not affected by the D510E mutation (Fig. 3E). However, FBXW7-mediated ubiquitination of NICD on Lysine K48, generally associated with proteasomal degradation, was significantly decreased for D510E compared with WT FBXW7 (Fig. 3E).

Fig. 3.

Fig. 3.

Open in a new tab

FBXW7 mutants reduced binding and ubiquitin-mediated degradation of NICD. (A) FBXW7-mediated degradation of NICD was analyzed by Western blot (WB) and compared with control plasmid (pcDNA). FBXW7 WT and R505C were used as positive and negative controls, respectively. The NICD expression was quantified as relative to control normalized as 100% (WT 53%, R505C 115%, W406R 56%, T416A 61%, W425R 80%, L443F 100%, S462P 117%, H468R 111%, D510E 105%, and D527G 91%). (B) Expression of FBXW7 mutants increased the half-life of NICD. The effect of FBXW7 or mutants on the half-life of NICD was analyzed by Western blot after 100 μg/mL cycloheximide (CHX) treatment for 0, 2, 4, and 6 h. Western blot for transfected NICD, FBXW7, and actin are presented. (C) The interaction between NICD and FBXW7 was analyzed in 293T cells transfected with Myc-tagged NICD and Flag-tagged FBXW7 WT or mutants. Immunoprecipitated NICD and WB FBXW7 showed the interaction between NICD and FBXW7 WT. (D) Interaction between S-phase kinase-associated protein 1 (SKP1) and FBXW7 was analyzed in 293T cells transfected with HA-SKP1 and Flag-tagged FBXW7 WT or mutants. IP SKP1 and Western blot FBXW7 showed the interaction between SKP1 and FBXW7. (E) FBXW7-mediated NICD ubiquitination was analyzed in 293T cells transfected with FBXW7 WT (lane 2) or D510E (lane 3), NICD, and HA-Ub (K63 or K48). Cells were treated with MG132 for 6 h before harvest. Immunoprecipitated NICD and Western blot Ub showed the ubiquitination level of NICD.

"VSports app下载" Novel Oncogenic FBXW7 Mutants Promote Cellular Transformation and IL-2–Independent Growth of Tax-Immortalized T Cells.

HTLV-I Tax’s transforming abilities have been characterized in vitro using a Rat1 fibroblast colony formation assay (16, 17). We next tested whether ATL FBXW7 mutants could increase Tax-transforming activity. Interestingly, two ATL FBXW7 mutants, D510E and D527G, were able to stimulate the transforming activity of Tax and increase colony formation by 50% and 35%, respectively (Fig. 4 A and B). These mutants had no transforming effects on their own (Fig. 4 A and B). Increased Tax transforming activity was not related to changes in Tax expression as demonstrated by Western blot assays (Fig. 4C). In addition, as reported above for the W425R mutant, the D510E mutation acted as a dominant-negative preventing WT FBXW7-mediated degradation of NICD (Fig. 4C). Previously characterized FBXW7 mutant R505C was not able to cooperate with Tax in transformation assays. Interestingly, the oncogenic activity of the D510E mutant was also observed when coexpressed with either p53 R276H or c-Myc F138C (Fig. 4D), two mutants found in human cancers (18, 19). Our results suggest that FBXW7 has a tumor-suppressor effect in ATL cells but acquisition of specific mutations may result in shifting to a transforming phenotype. We next validated our results in the context of human T cells. In the early stages of the disease, chronic or smoldering ATL cells rely on autocrine loops IL-2/IL-2Rα and IL-15/IL-15Rα for their proliferation. In vitro, transformation by HTLV-I is characterized by IL-2–independent growth and acquisition of constitutive JAK/STAT activation (20). We cloned FBXW7 and the D510E mutant into a lentiviral vector for delivery into the IL-2–dependent Tax-immortalized WT4 T cells. Two days after infection, cells were grown in the absence of IL-2. After 8 wk in culture, all cells infected with FBXW7 had died but WT4 D510E cells were still alive and proliferating in the absence of IL-2 (Fig. 4E), suggesting that D510E is able to facilitate transformation of IL-2–dependent Tax-expressing human T cells.

Fig. 4.

Fig. 4.

Open in a new tab

FBXW7 mutants promote cellular transformation. (A) FBXW7 mutants increase Tax-transforming activity. Rat1 cell colony formation was evaluated after cells were transfected with the indicated plasmids and puromycin selection. The transformation efficiencies were normalized to Tax alone, which was set as 100%. The data were from two independent experiments and shown as the average. Increased number of transformed foci observed for D510E and D527G were statistically significant. (B) Photographs of transformed foci were shown (AMG EVOS XL core with 20× objective). (C) Western blot showed the expression of Tax and FBXW7. Actin served as a loading control. NICD expression in 293T cells transfected with NICD, FBXW7 WT, and a dose increase of D510E were analyzed by Western blot (Lower). (D) FBXW7 mutants increase p53 R276H and c-Myc F138C transforming activities analyzed as in A. The transformation efficiencies were normalized to p53 R276H and c-Myc F138C, respectively. The data were from two independent experiments and shown as the average with SD. (E) WT4 cells infected with lentivirus encoding FBXW7 WT or D510E were cultured in medium with or without IL-2 for 8 wk. Photographs of cell colonies are shown (AMG EVOS XL core with 20× objective). (F) FBXW7 WT and mutant-mediated substrate degradation were analyzed by Western blot after transient transfection. (G) Cellular proliferation of MT1 cells expressing FBXW7 WT and D510E were evaluated by cell count. The data were from two independent experiments and shown as the average with SD. (H) Degradation of endogenous substrates NICD, c-Myc, and cyclin E by FBXW7, W425R, S462P, and D510E mutant were analyzed by Western blot in ATL cells (MT1).

FBXW7 D510E Mutant Increases the Tumor Formation in an ATL Mouse Model.

To gain some insight into the D510E mutant, we performed transient transfection assays and found that FBXW7 D510E retained its ability to target c-Myc and Cyclin E for degradation, but not NICD (Fig. 4F). WT FBXW7 and previously characterized R505C, which are unable to target proteins for proteasome degradation, were used as controls (Fig. 4F). To determine the physiological relevance of our studies, we next investigated whether FBXW7 D510E can promote ATL tumor cell growth in vivo. MT1 ATL-transformed cells were stably transduced with a TET-inducible vector expressing the FBXW7 D510E mutant or FBXW7 WT. In vitro proliferation assays demonstrated that MT1 cells expressing the D510E mutant expanded more rapidly (Fig. 4G). Importantly, the selective defect of D510E mutant for NICD degradation was also confirmed on endogenous proteins (NICD, c-Myc, and Cyclin E) in MT1 ATL cells (Fig. 4H). To next investigate the ability of D510E to stimulate ATL tumor growth in vivo, we injected an equivalent number of MT1 FBXW7 or D510E cells in the right or left flanks of NOG (NOD/Shi-scid/IL-2Rγnull) mice. Mice received daily doxycycline in the drinking water and tumor volume was recorded every 3 d. After 21 d, the animals were killed and tumors excised (Fig. 5A). As expected from the data presented in Fig. 4, levels of NICD were higher in cells expressing D510E compared with WT FBXW7 (Fig. 5A). Examination of tumors revealed a significant increase in volume and weight for ATL cells expressing the D510E mutant compared with WT FBXW7 control (Fig. 5 B–C). Overall, these results confirm our in vitro transformation assays and suggest that the FBXW7 D510E mutation has tumor-forming potential in cooperation with other oncogenes.

Fig. 5.

Fig. 5.

Open in a new tab

FBXW7 D510E increased the tumor formation in vivo. (A) MT1 FBXW7 (n = 5) or D510E (n = 5) TET-On cells were injected into the right or left flank of NOG mice. Pictures are representative of excised tumors from injected mice. Western blot for NICD (Val-1744) expression in tumor samples is shown. (B) In vivo tumor growth curves, plotted as the average tumor volume (mm3) [calculated as the (width2 × length)/2]. P values were calculated using a two-sided student’s t-test between the tumor volumes for FBXW7 vs. D510E. (C) Tumor weight (in grams) for FBXW7 and D510E tumors taken at the time of sacrifice. P values were calculated using a two-sided student’s t-test between the tumor weight for FBXW7 vs. D510E. The mean tumor weight was indicated with a bar and green square, with the SD indicated.

VSports最新版本 - Discussion

In this study we report genetic mutations in the FBXW7 gene of acute ATL patients. In vitro established HTLV-I–transformed ATL cells demonstrate low levels of FBXW7 mRNA but similar mRNA half-life compared with PBMCs, suggesting transcriptional repression of the FBXW7 promoter in these cells. In contrast, analyses of freshly isolated and uncultured ATL samples demonstrated variable levels of FBXW7 mRNA expression, which was reduced in approximately one-third of ATL patients. Because ATL cells expressing or not expressing Tax had low levels of FBXW7, we think the mechanism is largely Tax-independent. Several reports suggest that a low level of FBXW7 expression is associated with increased malignancy potential, lymph node metastasis, and poorer prognosis in cancer patients (21, 22). The existence of additional posttranscriptional mechanisms to reduce FBXW7 expression, such as miR-223, miR-92a, and miR-27a regulation, has also been reported (11). Of note, we previously found that miR-223 is up-regulated in uncultured ATL samples, suggesting that miR-223 may contribute to suppression of FBXW7 in ATL cells in vivo. Our data confirmed that FBXW7 acts as a tumor suppressor in ATL cells and significantly reduces tumor cell proliferation, thereby justifying the requirement for its inactivation. In a recent study by Kataoka et al. (23), 81 ATL samples were analyzed by exome sequencing and the rate of mutation for FBXW7 was found to be much lower than in our study. However, using the same patient cohort we used in this study, we recently found a similar rate of mutation for STAT3 (25.5% in Caribbean vs. 21% for Japanese samples) (23, 24). Therefore, we believe the rate of mutation may be higher for FBXW7 in the Caribbean population. In support of this notion, using the 1000 Genomes Project Consortium database, we found the frequency of FBXW7 single nucleotide polymorphism (SNPs) to be higher in Caribbean samples compared with Japanese samples. In the total population the frequency of SNPs at FBXW7 was 1.05% similar to Japanese 1.08%. However, the Caribbean frequency of FBXW7 SNPs was significantly higher, 1.42%. In addition, we observed that Caribbean individuals had a greater amount of unique SNPs (1,174) at the FBXW7 locus compared with Japanese samples (762). The data demonstrate that individuals of Caribbean descent have a greater frequency of FBXW7 SNPs. In addition, another difference between the two studies is that we analyzed only acute ATL, whereas Kataoka et al. (23) analyzed mixed acute, chronic, smoldering, and lymphoma ATL (acute 47%, lymphoma 16%, chronic 31%, and smoldering 6%). If the mutation occurs in a later stage of the disease, that may also explain the different rate of mutation between the studies.

Importantly, our study identified two mutants, FBXW7 D510E and D527G, which retained their ability to target endogenous Cyclin E, MCL-1, and c-Myc for proteasome degradation but were unable to degrade NICD in ATL cells. This observation contrasts with a previously reported phenotypes of FBXW7 mutants found in other cancers for which mutations abolish all substrate degradation. The reason why the D510E mutation selectively abolishes degradation of NICD but no other substrates is unclear. D510E retains its ability to interact with NICD but was much less efficient in promoting K48 ubiquitination of NICD. The mechanism underlying D510E and D527G oncogenic activity remains to be demonstrated. Other mutations may also play a different role. For example, several reports indicate that a mutation in FBXW7 can contribute to drug resistance (14) or promote metastasis. Deregulated MYC and FBXW7 has been associated with the presence of lymph node metastasis and poor prognosis in gastric cancers, and a distinctively poor prognosis in gastric cancer patients who had low FBXW7 expression levels and mutated p53 (22). In addition, several studies showed that FBXW7 gene mutation and hyperphosphorylation of cyclin E, which usually correlates with FBXW7 mutation, have a significant association with polyploidy and aneuploidy (25). Because aneuploidy is also a characteristic of acute ATL, it will be important to determine if loss of FBXW7 affects chromosome segregation in ATL cells. In vivo FBXW7 mutation knock-in mice showed cooperation with specific signaling pathways, such as activated Notch or mutated adenomatous polyposis coli and accelerated tumor formation (26, 27). However, to our knowledge, this study is the first example describing cooperative oncogenic activities of mutated FBXW7 with a viral oncogene (HTLV-I Tax), p53, or c-Myc. Given the high rate of mutation of both p53 and c-Myc in human cancers, selective loss of FBXW7 functions may play a more active role than previously anticipated in the transformation process and warrants more study. Finally, an FBXW7 mutation may also provide novel therapeutic opportunities inasmuch as ablation of FBXW7 abrogates quiescence in leukemia-initiating cells, thereby increasing sensitivity to Imatinib. In fact, the combination of FBXW7 ablation with Imatinib treatment resulted in a greater depletion of leukemia-initiating cells than of normal hematopoietic stem cells in mice (28). Glucocorticoid receptor-α is a substrate of FBXW7 and inactivation of FBXW7 has been linked to a higher level of glucocorticoid receptor-α expression in T-ALL. This result was associated with a better prognosis and an increased sensitivity of leukemia cells to steroid therapies (29), suggesting that loss of FBXW7 may create opportunities for specific anticancer therapies.

"V体育官网" Materials and Methods

Patients and Cell Lines.

Samples from 32 ATL patients were obtained after informed consent in a study approved by the Institutional Review Board to the National Institutes of Health and the Necker Hospital, and were used for FBXW7 sequencing as previously reported (8). The 293T, U2OS, and Rat1 cells were cultured in DMEM with 10% (vol/vol) FBS. ATL cell lines MT1, ATL-T, ED40515(–), TL-Om1, and ATL-25 were cultured in RPMI-1640 with 10% (vol/vol) FBS. ATL cell line ATL-43T and Tax-immortalized WT4 T cells were grown in 20% (vol/vol) FBS and IL-2.

Animal Studies.

All animal studies were performed by Advanced Bioscience Laboratories. Protocols were reviewed and approved by Advanced Bioscience Laboratories’s Institutional Review Board. To study the oncogenic role of FBXW7 D510E in ATL tumor growth, 8-wk-old female NOG mice were used. Before injection of ATL cells, mice were given 2 mg/mL doxycycline (Vibramycin Monohydrate) in the drinking water with 2% sucrose for 7 d. The water was thereafter changed every day. Each animal received 5 × 107 ATL cell controls MT1-TripZ-WT and MT1-TripZ-D510E in the right and the left flank, respectively. Tumor growth was monitored three times a week for 21 d.

Plasmids and Transfections. (VSports最新版本)

Polyfect (Qiagen) was used for 293T transfection. Calcium Phosphate Transfection Kit (Invitrogen) was used for Rat1 cell transfection and for lentivirus production. FBXW7 mutant plasmids were generated by QuikChange Site-Directed Mutagenesis Kit (Agilent). FBXW7 WT and mutants were cloned into the pTripZ inducible vector (Thermo).

"V体育ios版" Western Blot and Coimmunoprecipitation.

Cells were lysed in RIPA lysis buffer. Antibodies: anti-Myc (9E10; Roche), anti-actin (Santa Cruz), anti-Flag (Sigma), and anti-HA (3F10) (Roche) were used for the Western blots. For FBXW7 and NICD interaction by coimmunoprecipitation, 293T cells were cotransfected with the Myc-tagged NICD and Flag-tagged FBXW7 plasmids. After 48 h, cells were harvested in Nonidet P-40 lysis buffer, IP with anti-Myc antibody and Western blot. Nuclear protein extracts of MT1 cells expressing FBXW7 WT or mutants were used for endogenous NICD Western blot analyses.

Cycloheximide Chase.

293T cells were cotransfected with 100 ng Myc-tagged ICN1 and 1 μg Flag-tagged FBXW7 WT or mutants for 48 h. Before harvest, cells were treated with 100 μg/mL cycloheximide for 0, 2, 4, and 6 h. Anti-Myc and anti-Flag antibodies were used for the Western blots.

Luciferase Assays.

Luciferase assays were performed with the Luciferase Reporter Assay Kit (Promega) according to the manufacturer’s instructions. Luciferase assays were repeated at least twice from independent experiments and results were normalized to protein concentration.

Ubiquitination Assays.

293T cells were transfected with Myc-tagged NICD, Flag-tagged FBXW7, and HA-tagged Ub (K48 or K63) for 48 h. Cells were treated with 10 μM MG132 for 6 h. Cells were collected with RIPA lysis buffer containing N-ethylmaleimide, iodoacetamide, and EDTA, then immunoprecipitated with anti-Myc antibody and immunoblotted.

Rat1 Cell Transformation Assays.

After 72-h transfection, Rat1 cells transfected with indicated plasmid were subjected to puromycin selection. Cell culture medium was changed once a week. After a month, the colonies were fixed and stained with Crystal violet.

fChIP Assays.

FBXW7 WT or mutant MT1 cells (seeded at 1 × 106 cells per milliliter) were treated for 48 h with 2 μg/mL doxycycline or 72 h with ± Compound E (1 μM). Cells were cross-linked 10 min with 1% (CF) formaldehyde, stopped with 0.125 M glycine (CF), washed, and DNA was sheared by sonication. ChIP was performed with the ChIP Assay Kit (Millipore), anti-Notch (ab27526; Abcam), according to the manufacturer’s instructions. CHIP-quantitative PCR (qPCR) was performed with SYBR green qPCR using Hes1-CHIP primers (F:CTGTGGGAAAGAAAGTTTGGG and R:GACCAAGGAGAGAGGTAGAC). Data were normalized using a percent input method (= 100 × 2[Adjusted input-Ct (IP)]. Amplified products were cloned into pGEM-T easy vector (Promega) to verify sequence.

Acknowledgments

The authors thank Brandi Miller for editorial assistance. The research was supported by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health under Award R21AI103851 (to C.N.).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission. B.R.C. is a guest editor invited by the Editorial Board.

V体育ios版 - References

  • 1.Tsukasaki K, et al. Definition, prognostic factors, treatment, and response criteria of adult T-cell leukemia-lymphoma: A proposal from an international consensus meeting. J Clin Oncol. 2009;27(3):453–459. doi: 10.1200/JCO.2008.18.2428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Nicot C. Tumor suppressor inactivation in the pathogenesis of adult T-cell leukemia. J Oncol. 2015;2015:183590. doi: 10.1155/2015/183590. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Sun SC, Yamaoka S. Activation of NF-kappaB by HTLV-I and implications for cell transformation. Oncogene. 2005;24(39):5952–5964. doi: 10.1038/sj.onc.1208969. [DOI (VSports注册入口)] [PubMed] [Google Scholar]
  • 4.Sinha-Datta U, et al. Transcriptional activation of hTERT through the NF-kappaB pathway in HTLV-I-transformed cells. Blood. 2004;104(8):2523–2531. doi: 10.1182/blood-2003-12-4251. [DOI (V体育ios版)] [PubMed] [Google Scholar]
  • 5.Tabakin-Fix Y, Azran I, Schavinky-Khrapunsky Y, Levy O, Aboud M. Functional inactivation of p53 by human T-cell leukemia virus type 1 Tax protein: mechanisms and clinical implications. Carcinogenesis. 2006;27(4):673–681. doi: 10.1093/carcin/bgi274. [DOI] [PubMed] [Google Scholar]
  • 6.Chaib-Mezrag H, et al. Tax impairs DNA replication forks and increases DNA breaks in specific oncogenic genome regions. Mol Cancer. 2014;13:205. doi: 10.1186/1476-4598-13-205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Baydoun HH, Bai XT, Shelton S, Nicot C. HTLV-I tax increases genetic instability by inducing DNA double strand breaks during DNA replication and switching repair to NHEJ. PLoS One. 2012;7(8):e42226. doi: 10.1371/journal.pone.0042226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Pancewicz J, et al. Notch signaling contributes to proliferation and tumor formation of human T-cell leukemia virus type 1-associated adult T-cell leukemia. Proc Natl Acad Sci USA. 2010;107(38):16619–16624. doi: 10.1073/pnas.1010722107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kourtis N, Strikoudis A, Aifantis I. Emerging roles for the FBXW7 ubiquitin ligase in leukemia and beyond. Curr Opin Cell Biol. 2015;37:28–34. doi: 10.1016/j.ceb.2015.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Davis RJ, Welcker M, Clurman BE. Tumor suppression by the Fbw7 ubiquitin ligase: Mechanisms and opportunities. Cancer Cell. 2014;26(4):455–464. doi: 10.1016/j.ccell.2014.09.013. ["VSports注册入口" DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wang L, Ye X, Liu Y, Wei W, Wang Z. Aberrant regulation of FBW7 in cancer. Oncotarget. 2014;5(8):2000–2015. doi: 10.18632/oncotarget.1859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Xu Y, Sengupta T, Kukreja L, Minella AC. MicroRNA-223 regulates cyclin E activity by modulating expression of F-box and WD-40 domain protein 7. J Biol Chem. 2010;285(45):34439–34446. doi: 10.1074/jbc.M110.152306. [DOI (VSports最新版本)] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bellon M, Lepelletier Y, Hermine O, Nicot C. Deregulation of microRNA involved in hematopoiesis and the immune response in HTLV-I adult T-cell leukemia. Blood. 2009;113(20):4914–4917. doi: 10.1182/blood-2008-11-189845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.O’Neil J, et al. FBW7 mutations in leukemic cells mediate NOTCH pathway activation and resistance to gamma-secretase inhibitors. J Exp Med. 2007;204(8):1813–1824. doi: 10.1084/jem.20070876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Jenkinson S, et al. Impact of NOTCH1/FBXW7 mutations on outcome in pediatric T-cell acute lymphoblastic leukemia patients treated on the MRC UKALL 2003 trial. Leukemia. 2013;27(1):41–47. doi: 10.1038/leu.2012.176. [DOI] [PubMed] [Google Scholar]
  • 16.Liu Y, et al. Phosphoinositide-3 kinase-PKB/Akt pathway activation is involved in fibroblast Rat-1 transformation by human T-cell leukemia virus type I tax. Oncogene. 2001;20(20):2514–2526. doi: 10.1038/sj.onc.1204364. [DOI] [PubMed] [Google Scholar]
  • 17.Tanaka A, et al. Oncogenic transformation by the tax gene of human T-cell leukemia virus type I in vitro. Proc Natl Acad Sci USA. 1990;87(3):1071–1075. doi: 10.1073/pnas.87.3.1071. [DOI (VSports app下载)] [PMC free article] [PubMed] [Google Scholar]
  • 18.Muller PA, Vousden KH. p53 mutations in cancer. Nat Cell Biol. 2013;15(1):2–8. doi: 10.1038/ncb2641. [DOI] [PubMed] [Google Scholar]
  • 19.Yano T, et al. Clustered mutations in the second exon of the MYC gene in sporadic Burkitt’s lymphoma. Oncogene. 1993;8(10):2741–2748. [PubMed (V体育官网入口)] [Google Scholar]
  • 20.Migone TS, et al. Constitutively activated Jak-STAT pathway in T cells transformed with HTLV-I. Science. 1995;269(5220):79–81. doi: 10.1126/science.7604283. [DOI] [PubMed] [Google Scholar]
  • 21.Grim JE, et al. Fbw7 and p53 cooperatively suppress advanced and chromosomally unstable intestinal cancer. Mol Cell Biol. 2012;32(11):2160–2167. doi: 10.1128/MCB.00305-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yokobori T, et al. p53-Altered FBXW7 expression determines poor prognosis in gastric cancer cases. Cancer Res. 2009;69(9):3788–3794. doi: 10.1158/0008-5472.CAN-08-2846. ["VSports最新版本" DOI] [PubMed] [Google Scholar]
  • 23.Kataoka K, et al. Integrated molecular analysis of adult T cell leukemia/lymphoma. Nat Genet. 2015;47(11):1304–1315. doi: 10.1038/ng.3415. [DOI] [PubMed] [Google Scholar]
  • 24.Bellon M, Lu L, Nicot C. Constitutive activation of Pim1 kinase is a therapeutic target for adult T-cell leukemia. Blood. 2016;127(20):2439–2450. doi: 10.1182/blood-2015-11-685032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Rajagopalan H, et al. Inactivation of hCDC4 can cause chromosomal instability. Nature. 2004;428(6978):77–81. doi: 10.1038/nature02313. [DOI (VSports最新版本)] [PubMed] [Google Scholar]
  • 26.King B, et al. The ubiquitin ligase FBXW7 modulates leukemia-initiating cell activity by regulating MYC stability. Cell. 2013;153(7):1552–1566. doi: 10.1016/j.cell.2013.05.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Davis H, Lewis A, Behrens A, Tomlinson I. Investigation of the atypical FBXW7 mutation spectrum in human tumours by conditional expression of a heterozygous propellor tip missense allele in the mouse intestines. Gut. 2014;63(5):792–799. doi: 10.1136/gutjnl-2013-304719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Takeishi S, et al. Ablation of Fbxw7 eliminates leukemia-initiating cells by preventing quiescence. Cancer Cell. 2013;23(3):347–361. doi: 10.1016/j.ccr.2013.01.026. [DOI] [PubMed] [Google Scholar]
  • 29.Malyukova A, et al. FBXW7 regulates glucocorticoid response in T-cell acute lymphoblastic leukaemia by targeting the glucocorticoid receptor for degradation. Leukemia. 2013;27(5):1053–1062. doi: 10.1038/leu.2012.361. [DOI] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES