V体育官网 - Skip to main content
NCBI home page
EMBO Reports logoLink to EMBO Reports
. 2022 Jul 14;23(9):e54611. doi: 10.15252/embr.202254611

Vitamin D receptor enhances NLRC4 inflammasome activation by promoting NAIPs–NLRC4 association (V体育2025版)

Xin Chen 1, † , Zaikui Zhang 1, † , "V体育安卓版" Naishuang Sun 1, Jinzhou Li 1, Zemeng Ma 1, Zebing Rao 1, Xiaomeng Sun 1, Qiang Zeng 1, Yuxuan Wu 1, Jiahuang Li 2,✉, Jing Zhang 3,✉, Yunzi Chen 1,4,✉
PMCID: PMC9442308  PMID: 35833522

Abstract

Inflammasomes are cytosolic multiprotein complexes that initiate host defense against bacterial pathogens. The nucleotide‐binding oligomerization domain (NOD)‐like receptor (NLR) family caspase‐associated recruitment domain‐containing protein 4 (NLRC4) inflammasomes plays a critical role in the inflammatory response against intracellular bacterial infection. The NLR family apoptosis inhibitory proteins (NAIPs) detect Flagellin or type III secretion system (T3SS) microbial components to activate NLRC4 inflammasome. However, the underlying mechanism of NLRC4 inflammasome activation is not completely understood. Here, we show that the vitamin D receptor (VDR) is an essential immunological regulator of the NLRC4 inflammasome V体育平台登录. Conditional VDR knockout mice (VDRflox/flox lyz2‐Cre) exhibited impaired clearance of pathogens after acute Salmonella Typhimurium infection leading to poor survival. In macrophages, VDR deficiency reduced caspase‐1 activation and IL‐1β secretion upon S.  Typhimurium infection. For NAIPs act as upstream sensors for NLRC4 inflammasome assembly, the further study demonstrated that VDR promoted the NAIP–NLRC4 association and triggered NAIP–NLRC4 inflammasome activation, not NLRP3 activation. Moreover, Lys123 residue of VDR is identified as the critical amino acid for VDR‐NLRC4 interaction, and the mutant VDR (K123A) effectively attenuates the NLRC4 inflammasome activation. Together, our findings suggest that VDR is a critical regulator of NAIPs–NLRC4 inflammasome activation, mediating innate immunity against bacterial infection.

Keywords: NLRC4 inflammasome, S.  Typhimurium infection, VDR VSports注册入口.

Subject Categories: Immunology; Microbiology, Virology & Host Pathogen Interaction

VDR is a critical regulator of NAIPs–NLRC4 inflammasome activation, which mediates innate immunity against bacterial infections.

graphic file with name EMBR-23-e54611-g002.jpg

Introduction

The NLR protein NLRC4 is a member of the NOD‐like receptor family sensing a range of intracellular bacteria and plays a crucial role in the innate immune system. Ligands from Gram‐negative bacteria such as needles and inner nod protein of the Type 3 secretion system (T3SS) can be detected by NAIPs. After detecting T3SS protein, NAIP associates with NLRC4 to induce the assembly of NAIP–NLRC4 inflammasome leading to caspase‐1activation. Activated caspase‐1 processes IL‐1β release and triggers Gasdermin D (GSDMD)‐mediated pyroptosis (Zhao et al, 2011; Lage et al, 2014; Vance, 2015; Zhao & Shao, 2015; Duncan & Canna, 2018; Bauer & Rauch, 2020; Gram et al, 2021) V体育2025版. Like all NLR family members, NLRC4 shares a typical three‐domain structure: an N‐terminal caspase‐activation and recruitment domain (CARD), a central nucleotide‐binding domain, and a C‐terminal leucine‐rich repeat (LRR) domain (Sundaram & Kanneganti, 2021). The activation of NLRC4 inflammasome requires NAIP proteins (NAIP1, NAIP2, NAIP5, and NAIP6 in mice) for sensing bacterial components in the cytosol (Gong & Shao, 2012; Lage et al, 2014; Tenthorey et al, 2014; Gram et al, 2021). For bacteria that produce different amounts of multiple NAIP ligands with varying affinity, the degree of NLRC4 inflammasome activation is complex. Although the specific ligands for NLRC4 inflammasome have been examined in detail, the upstream regulators for NAIP–NLRC4 inflammasome assembly remain unclear and need further investigations.

More recent evidence demonstrates that vitamin D is an immunoregulatory hormone that modulates the innate and adaptive immune system (Gatti et al, 2016; Carlberg, 2019; Ismailova & White, 2021) VSports. Vitamin D receptor (VDR) is a nuclear receptor and mediates the biological activity of vitamin D3 (the active form of vitamin D). VDR deficiency is associated with inflammatory diseases, such as inflammatory bowel disease, sepsis, diabetes, and asthma (Liu et al, 2013; Pappa, 2014; Madanchi et al, 2018; Kim et al, 2020). Vitamin D has been identified as a potent stimulator of autophagy in infection and HIV infection (Ismailova & White, 2021). VDR negatively regulated bacteria‐induced NF‐κB activity in intestinal inflammation (Wu et al, 2010). We previously reported that VDR inhibits NLRP3 inflammasome activation (Rao et al, 2019). We investigated whether VDR has a similar role in NLRC4 inflammasome activation for its importance in cellular immunity.

Here, we report a novel role of VDR in the optimal activation of the NLRC4 inflammasome. Our findings show that VDR promotes ligand‐bound NAIP association with NLRC4 and enhances the activation of NLRC4 inflammasome, contributing to host defense against bacterial pathogens VSports app下载.

Results

V体育2025版 - VDR deficiency impairs NLRC4‐dependent inflammasome activation

To determine the role of VDR in NLRC4 inflammasome activation, we first examined inflammasome activation in response to Salmonella Typhimurium infection in VDR‐deficient and WT BMDMs. VDR‐deficient macrophages showed reduced pro–caspase‐1 activation and Gasdermin D cleavage (Fig 1A), IL‐1β and IL‐18 secretion (Fig 1B and C), and LDH release (Fig 1E), but no changes in TNFα production compared with WT macrophages (Fig 1D), indicating the defective effect specific to inflammasome activation. Consistently, the recovery expression of VDR in Vdr−/− BMDMs rescued the caspase‐1 activation and IL‐1β production (Fig 1F). Using NLRC4 inflammasome‐specific ligands (Flic and PrgJ) to induce NLRC4 inflammasome activation, similar results were observed in Vdr−/− BMDMs (Fig 1G). To further examine whether VDR is involved in NLRC4 inflammasome activation, BMDMs from Nlrc4−/− and Nlrc4−/− Vdr−/− mice were prepared for FLIC stress, Nlrc4−/− and Nlrc4−/− Vdr−/− BMDMs showed similar inflammasome activation defects in response to FLIC (Fig 1H–L). In addition, we tested the role of VDR in NLRC4 inflammasome activation in human cells and examined the caspase‐1 and IL‐1β cleavage in response to S.  Typhimurium infection in VDR‐deficient (sh‐VDR) and control THP‐1 cells; VDR‐deficient THP‐1 cells showed reduced pro–caspase‐1 and pro‐IL‐1β activation (Fig EV1A), and LDH release (Fig EV1B) V体育官网. Collectively, these data indicate that VDR is required for the optimal activation of the NLRC4 inflammasome.

Figure 1. VDR deficiency impairs NLRC4‐dependent inflammasome activation.

Figure 1

Open in a new tab
  • A–H
    LPS‐primed WT and Vdr−/− BMDMs were infected with 50 MOI S. Typhimurium for 2 h. Culture supernatants (SN) and cell lysates(Lysate) were collected and immunoblotted with the indicated antibodies (A). (B–E) IL‐1β secretion (B), IL‐18 secretion (C) and TNF‐ɑ secretion (D) and LDH release (E) in supernatants. (F) HBVLV‐Vdr expression in Vdr−/− BMDMs by lentivirus‐mediated transduction primed with LPS and infected with 50 MOI S. Typhimurium for 2 h, cell lysates, and culture supernatants (SN) were collected and immunoblotted with the indicated antibodies. (G) LPS‐primed WT and Vdr−/− BMDMs were treated with 1 μg/ml FLIC (LFn‐Flagellin and PA) or PrgJ (1 μg/ml LFn‐ PrgJ and PA) for 1 h, total mixtures (culture supernatants and cell lysates) were collected and immunoblotted with the indicated antibodies. (H) LPS‐primed WT, Vdr−/−, NLRC4−/− and Vdr−/−NLRC4−/− BMDMs were treated with FLIC for 1 h, Culture supernatants (SN) and cell lysates were collected and immunoblotted with the indicated antibodies.
  • I–L
    IL‐1β secretion (I), IL‐18 secretion (J) and TNF‐ɑ secretion (K) and LDH release (L) in supernatants. Data are shown as means ± SEM; determined by Student's t‐test; *, P < 0.05; **, P < 0.01 In each panel, data are representative of at least three independent experiments.

Source data are available online for this figure VSports手机版. .

Figure EV1. VDR deficiency impairs NLRC4‐dependent inflammasome activation, and VDR interacts with NLRC4 in THP‐1.

Figure EV1

Open in a new tab (VSports手机版)
  • A, B
    THP‐1 were infected with lentivirus, which expressed Vector (NC) or shRNA‐VDR (VDR‐silence), infected with S. Typhimurium at an MOI of 50 for 2 h, Toal lysates (cell lysates and culture supernatants) were collected and immunoblotted with the indicated antibodies (A). LDH release (B).
  • C, D
    LPS‐primed THP‐1 were infected with S. Typhimurium at an MOI of 50 for 45 min. Lysates were immunoprecipitated (IP) using an anti‐VDR antibody (C) or anti‐NLRC4 (D) and were immunoblotted with the indicated antibodies. Whole‐cell lysates were shown as the input.

Data information: Data are shown as means ± SEM; determined by Student's t‐test; ***, P < 0.001; NC: negative control; In each panel, data are representative of at least three independent experiments.

Source data are available online for this figure.

VDR is involved in host defense against S. Typhimurium infection, independent of NLRP3

Then, we sought to determine whether VDR deficiency in macrophages reduces NLRC4 inflammasome activation in vivo. Conditional knockout VDR transgenic mice (VDRflox/flox lyz2‐Cre) were generated via crossing VDR‐floxed mice with lyzm2‐Cre mice (Fig EV2A and B). The peritonitis was induced in VDRflox/flox lyz2‐Cre and the littermate control mice (VDRflox/flox) by intraperitoneal injection with 107 CFUs of S. Typhimurium. After 6‐h infection, IL‐1β levels were significantly reduced in the peritoneal cavity‐flushed fluids (PCFs) and the sera from VDRflox/flox lyz2‐Cre mice compared with control mice (Fig 2A and C). Meanwhile, TNFɑ levels showed no differences between the two groups of mice, supporting that the effect of VDR is specific to inflammasome activation (Fig 2B and D). The previous study showed that IL‐1β is essential for controlling the infection, and NLRC4‐dependent IL‐1β production from the neutrophils is crucial for protecting mice in the S. Typhimurium‐induced peritonitis model (Liu et al, 2017), so we examined the recruitment of peritoneal neutrophils. The sorted neutrophils (CD11b+Ly6G+ cells) VDRflox/flox lyz2‐Cre mice were reduced compared with control mice (Fig 2E). The bacterial colonization was increased in the blood, PCF, and spleen from VDRflox/flox lyz2‐Cre mice bearing S. Typhimurium‐induced peritonitis model (Fig 2F and G). Moreover, 60% of VDRflox/flox lyz2‐Cre mice died after 4 days of infection, while 80% of control mice remained alive (Fig 2H). These data indicate that VDR protection against S. Typhimurium infection in mice may be associated with the NLRC4‐inflammasome activation.

Figure EV2. Schematic illustration of VDR‐floxed mice and analyzing VDRflox/flox lyz2‐Cre mice and VDR/NLRC4 localization.

Figure EV2

Open in a new tab
  • A
    Schematic illustration of VDR‐floxed mice.
  • B
    VDR expression was analyzed in BMDMs derived from VDRflox/flox and VDRflox/flox lyz2‐Cre mice by immunoblotting with the indicated mice.
  • C
    Flag‐VDR and Myc‐NLRC4 were expressed in HEK293T cells and immunofluorescent staining with anti‐Flag and anti‐Myc. Scale bar: 20 μM.

Figure 2. VDR is involved in host defense against S. Typhimurium infection.

Figure 2

"V体育2025版" Open in a new tab
  • A–H
    IL‐1β (A) and TNF‐ɑ (B) levels in sera and IL‐1β (C) and TNF‐ɑ (D) in PCF of littermate VDRflox/flox and VDRflox/flox lyz2‐Cre mice 6 h after S. Typhimurium (107 CFUs/mouse) infection with ELISA detecting. (E) The absolute number of neutrophils (CD11b+Ly6G+) from PCF of VDRflox/flox and VDRflox/flox lyz2‐Cre mice 6 h after S. Typhimurium infection. (F) Bacterial burden in blood, PCF, and spleens (G) of VDRflox/flox and VDRflox/flox lyz2‐Cre mice 24 h after S. Typhimurium infection. (H) Survival of littermate VDRflox/flox and VDRflox/flox lyz2‐Cre mice infected intraperitoneally with S. Typhimurium (102 CFUs/mouse). Data in (A–H) are shown as means ± SEM; determined by Student's t‐test; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001 or the Kaplan–Meier method (H). Data in (A–F) are representative of at least three independent experiments, and n = 5 mice/group (A–D, F–G) or n = 3 mice/group (E); data in (H) are representative of two independent experiments, and n = 10 mice/group.

The previous report showed that NLRP3 partially participates in NLRC4‐dependent inflammasome activation (Qu et al, 2016). To address whether NLRP3 is involved in VDR‐mediated inflammasome activation, BMDMs from VDR−/−Nlrp3−/−, Nlrp3−/−, VDR−/−, and WT mice were prepared for S. Typhimurium infection. The results showed similar responses between Nlrp3−/− and WT BMDMs, and VDR−/− and VDR−/−Nlrp3−/− BMDMs also showed similar responses to S. Typhimurium infection, such as caspase‐1 cleavage, TNFɑ and IL‐1β secretion (Fig 3A–C). Then, in vivo assays by intraperitoneal injection of S. Typhimurium into mice, the bacterial colonization in blood, PCF, and spleen displayed no significant differences between VDR−/−Nlrp3−/− and VDR−/− mice (Fig 3D–F). These data suggest that NLRP3 is not involved in the protective role of VDR in the defense against S. Typhimurium infection.

Figure 3. NLRP3 is not involved in the protective role of VDR in the defense against S. Typhimurium infection.

Figure 3

Open in a new tab
  • A–F
    LPS‐primed WT, Vdr−/−, NLRP3−/− and NLRP3−/− Vdr−/− BMDMs were infected with different MOI (0, 10, 50) S. Typhimurium for 2 h.Culture supernatants (SN) and Cell lysates were collected and immunoblotted with the indicated antibodies (A). ELISA detected TNF‐ɑ (B) and IL‐1β (C) in supernatants. Bacterial burden was detected in spleens (D), PCF (E), and blood (F) of WT, Vdr−/−, NLRP3−/−, and NLRP3−/− Vdr−/− mice 24 h after S. Typhimurium infection.

Data information: n ≥ 3 biological replicates. Data are presented as the mean ± SEM; determined by Student's t‐test; **P < 0.01.

Source data are available online for this figure.

V体育2025版 - VDR deficiency reduces ASC speck formation upon NLRC4 inflammasome activation

The activation of NLRC4 leads to the assembly of a macromolecule complex containing ASC formation (the adapter for inflammasome complex; Broz et al, 2010). Activated NLRC4 can associate with ASC and colocalizes with the ASC‐containing speck during S. Typhimurium infection (Vance, 2015). The effect of VDR on the ASC formation during NLRC4 inflammasome activation was examined in VDR‐deficient and WT macrophages. Upon S. Typhimurium infection, endogenous ASC specks were visualized by immunofluorescence staining. Compared with WT macrophages, the frequency of ASC speck–containing cells was significantly decreased in VDR‐deficient macrophages (Fig 4A), suggesting that VDR is required for ASC speck formation upon NLRC4 inflammasome activation.

Figure 4. VDR deficiency reduces ASC speck formation upon NLRC4 inflammasome activation.

Figure 4

Open in a new tab
  • A
    LPS‐primed WT and Vdr−/− BMDMs were infected with S. Typhimurium at an MOI of 50 for 2 h. Endogenous ASC specks (arrows) were represented and quantified by immunofluorescence images. The data show representative results from three independent experiments: scale bar, 20 μm. Data are presented as the mean ± SEM; determined by Student's t‐test; ***, P < 0.001.
  • B
    ASC oligomerization induced by the indicated stimuli in WT and Vdr−/− BMDMs primed with LPS.

For the ASC specks are oligomers of ASC protein that manifest as Triton X‐100‐insoluble aggregates, we analyzed the Triton X‐100–soluble and TritonX‐100–insoluble fractions from macrophages by Western blot. Consistent with fluorescent observation, the reduced oligomerization of ASC was detected in VDR‐deficient macrophages infected with S. Typhimurium, and its oligomer (Fig 4B). These data suggest that VDR participates in the assembly of the ASC–NLRC4 complex.

"V体育官网入口" VDR interacts with NLRC4

To illustrate the mechanism of VDR enhancing NLRC4 inflammasome activation, we checked the expression of genes related to the NLRC4 inflammasome in the absence of VDR. The results showed no significant difference in the expression of these genes, including NLRC4, pro‐caspase‐1, pro‐IL‐1β, Gasdermin D, ASC, NAIP2, and NAIP5 in WT and Vdr−/− BMDMs (Fig EV3A–D). Based on the above result of the reduced ASC speck formation in VDR‐deficient macrophages, further examination was focused on the interaction between the VDR and NLRC4 inflammasome. Co‐immunoprecipitation (Co‐IP) experiments indicated that endogenous VDR interacted with NLRC4 in BMDMs (Fig 5A) and THP‐1 cells (Fig EV1C and D). The VDR–NLRC4 association was confirmed by co‐IP assays in HEK293T cells with Flag‐VDR and Myc‐NLRC4 overexpression (Fig 5B and C) and visualized by immunofluorescence assays (Fig EV2C). In addition, in vitro assay with recombinant GST‐VDR protein further demonstrated that VDR interacted directly with NLRC4 (Fig 5D). To map the domain of NLRC4 required for the interaction with VDR, we generated a series of NLRC4 truncations, and the Co‐IP assay showed that the NACTH and LRR domain of NLRC4 interacted with VDR (Fig 5E). For VDR, the LBD domain of VDR (LBD‐VDR) was detected in the NLRC4 immunoprecipitation (Fig 5F). In addition, we also found that VDR had no effect on the phosphorylation of NLRC4 at Ser533 (Fig EV4), which is critical for the NLRC4 inflammasome activation following infection with S. Typhimurium (22, 23). Considering the LRR or NACTH domain of NLRC4 sequesters the protein as a monomeric state in an auto‐inhibitory conformation (Zhang et al, 2015), we speculate that the self‐inhibition of NLRC4 can be relieved by VDR interaction with the LRR or NACTH domain of NLRC4, contributing to the NLRC4 inflammasome activation.

Figure EV3. VDR deficiency does not affect the expression of genes related to the NLRC4 inflammasome.

Figure EV3

Open in a new tab
  • A–D
    Quantitative the Naip2 (A), Napi5 (B), and Nlrc4 (C) mRNA expression by real‐time PCR, and pro‐caspase‐1, pro‐IL‐1β, Gasdermin D, and ASC by immunoblotting with the indicated antibodies (D) in WT and Vdr−/− BMMDMs.

Data information: n ≥ 3 biological replicates. For all panels, Data are presented as the mean ± SEM; determined by Student's t‐test ns: No statistical significance.

Figure 5. VDR interacts with NLRC4.

Figure 5

Open in a new tab
  • A–F
    LPS‐primed BMDMs were infected with S. Typhimurium at an MOI of 50 for 2 h. Lysates were immunoprecipitated (IP) using an anti‐VDR antibody and were immunoblotted with the indicated antibodies (A). Whole‐cell lysates were shown as the input. (B, C) Flag‐VDR was co‐expressed with Myc‐NLRC4 in HEK293T cells; proteins were immunoprecipitated and analyzed by immunoblotting with indicated antibodies. Whole‐cell lysates were shown as the input. (D) Purified GST‐VDR was incubated with purified His‐NLRC4 for 2 h. His‐NLRC4‐bound to GST‐VDR was pulled down by glutathione beads and subjected to immunoblot analysis. (E) WT or mutant NLRC4 (CARD, NACHT, or LRR (leucine‐rich repeat)) and HA‐VDR were expressed in HEK293T cells, immunoprecipitated, and analyzed by immunoblotting with indicated antibodies. *no specific band. (F) WT or mutant VDR (DBD or LBD) and Myc‐NLRC4 were expressed in HEK293T cells, immunoprecipitated, and analyzed by immunoblotting with indicated antibodies. Data are representative of three independent experiments.

Figure EV4. VDR does not affect NLRC4 phosphorylation at Ser533.

Figure EV4

Open in a new tab

LPS‐primed WT and Vdr−/− BMDMs were infected with different MOI (0, 10, 50) S. Typhimurium for 2 h. Cell lysates were collected and immunoblotted with the indicated antibodies.

VDR enhances NAIPs–NLRC4 complex formation

NAIPs function as receptors for microbial molecules in the inflammasome pathway. The specific ligand‐receptor ligation stimulates a physical association of the NAIP with NLRC4 and undergoes co‐oligomerization to form the inflammasome complex for caspase‐1 activation. NAIP5 and its paralog in mice (NAIP2) recognize flagellin and the T3SS rod protein (Bauer & Rauch, 2020). We further investigate whether VDR is required to form the NAIP5/NAIP2 and NLRC4 complex. In co‐IP assays, besides Flagellin and PrgJ in the immunoprecipitated complex of NLRC4, we found that VDR overexpression increased the interaction between NAIP5/NAIP2 and NLRC4 upon flagellin or PrgJ stimulation (Fig 6A and B). As mentioned above, LBD‐VDR is necessary for VDR to associate with NLRC4, so a similar result was confirmed by LBD‐VDR overexpression. LBD‐VDR also enhanced the formation of the NAIP5/NAIP2–NLRC4 complex (Fig 6C and D). These results indicate that the role of VDR in the NLRC4 inflammasome pathway is to improve the NAIP5/NAIP2–NLRC4 complex formation.

Figure 6. VDR enhances NAIP interaction with NLRC4.

Figure 6

Open in a new tab
  • A–D
    HEK293T cells were transfected with Flag‐NLRC4, VDR, Myc‐FLagellin, and HA‐NAIP5 (A) or Flag‐NLRC4, VDR, Myc‐PrgJ and HA‐NAIP2 (B), or Flag‐NLRC4, LBD‐VDR, Myc‐FLagellin, and HA‐NAIP5 (C) or Flag‐NLRC4, LBD‐VDR, Myc‐PrgJ, and HA‐NAIP2 (D). Samples were immunoprecipitated with the anti‐Flag and analyzed by immunoblotting with indicated antibodies.

"V体育2025版" Lys123 of VDR is the critical amino acid required for the regulation of NLRC4 inflammasome activation

To clarify the molecular mechanism of VDR in the regulation of NLRC4 inflammasome activation, we used molecular docking to predict the critical binding site of VDR in the NLRC4 inflammasome formation. According to the calculation results, Lys123 residue of VDR has a high frequency as a protein–protein interaction site for NLRC4 (Fig EV5A–C). Predicted results indicated that Lys123 of VDR binds to Glu327 in the HD1 region of NLRC4 via an ionic bond, Gln324 and Asp597 in the LRR region via hydrogen bonds to stabilize the active conformation of NLRC4 (Fig 7A). Then, we constructed VDR (K123A) mutant to study VDR–NLRC4 interaction to testify to this prediction. As expected, VDR (K123A) showed a weak interaction with NLRC4 (Fig 7B). For PrgJ‐NAIP2‐NLRC4 complex formation, the inflammasome assembly was enhanced by VDR, not by VDR (K123A; Fig 7C), and when VDR (K123A) transfection into VDR−/− iBMDMs in response to S. Typhimurium infection, the activation of Caspase‐1, IL‐1β and IL‐18 production, Gasdermin D cleavage, and LDH release were decreased compared with VDR−/− iBMDMs (Fig 7D–G), but no changes in TNFα production (Fig 7H). In conclusion, Lys123 is the critical amino acid of VDR for NLRC4 inflammasome activation.

Figure EV5. Analysis VDR binds with NLRC4.

Figure EV5

Open in a new tab
  • A
    The docking frequency of VDR residues.
  • B
    The NLRC4‐VDR interface interaction.
  • C
    The model of NLRC4 polymerization and VDR activation.
  • D
    VDR does not be ubiquitinated on Lys123. Flag‐VDR or Flag‐VDRK123A were co‐transfected with Myc‐Ubi in HEK293T cells with MG132 treatment and IP with Myc, then analyzed by immunoblotting with the indicated antibodies.

Figure 7. VDR K123A mutation attenuates VDR regulation of NLRC4 inflammasome activation.

Figure 7

"VSports在线直播" Open in a new tab
  • A
    Predict possibility of interaction amino acids between lys123 of VDR and NLRC4.
  • B
    VDR or mutant VDR (K123A) and Myc‐NLRC4 were expressed in HEK293T cells, immunoprecipitated with the anti‐Flag antibody, and analyzed by immunoblotting with indicated antibodies.
  • C
    Transfected VDR or mutant VDR (K123A) and Flag‐NLRC4, Myc‐PrgJ, and HA‐NAIP2 in HEK293T cells, immunoprecipitated with the anti‐HA antibody, and analyzed by immunoblotting with indicated antibodies.
  • D
    Vdr−/− BMDMs were infected with lentivirus, which expressed Vector (NC), VDR, and VDR‐K123A, infected with S. Typhimurium at an MOI of 50 for 2 h, cell lysates (Lysate) and culture supernatants (SN) were collected and immunoblotted with the indicated antibodies.
  • E–H
    LDH release (E), IL‐1β secretion (F), IL‐18 secretion (G) and TNF‐ɑ secretion (H) in supernatants. Data are shown as means ± SEM; determined by Student's t‐test; **, P < 0.01; ***, P < 0.001; In each panel, data are representative of at least three independent experiments.

Source data are available online for this figure.

V体育平台登录 - Discussion

There is an emerging role for vitamin D3 in the innate immune system wherein it may influence cellular sensing and responses of macrophages and dendritic cells (13). Vitamin D receptors (VDR) are also identified in various immune cells and possess immunomodulatory properties. VDR deficiency is associated with increased inflammation and deregulation in inflammatory diseases, such as inflammatory bowel disease, sepsis, diabetes, and asthma (21). We established a VDRflox/flox lyz2‐Cre mouse model with selective KO of VDR expression in macrophages to investigate the role of VDR on the innate immune against S. Typhimurium infection. Our findings demonstrate that VDR acts as an endogenous regulator of NAIP–NLRC4 inflammasome assembly to modulate NLRC4 activation in the host defense against S. Typhimurium infection.

NLRC4 inflammasomes are activated by bacterial pathogens carrying Flagellin or the type III secretion system (T3SS) (22, 23). The specificity of the NLRC4 inflammasomes is dictated by the NAIPs sensor for different bacterial ligands (3, 4, 7). NAIP proteins possess a catalytic surface matching the oligomerization surface of NLRC4 to initiate NLRC4 oligomerization (24). Our results showed that VDR enhanced NAIPs binding to the NLRC4 complex via interaction with NLRC4 and promoted the NLRC4 oligomerization. During the activation of NLRC4, inactive NLRC4 is catalyzed to its active conformation and then self‐propagates the active conformation to form the wheel‐like architecture. We speculate that VDR binding to the LRR or NACTH domain of NLRC4 might help change the auto‐inhibitory conformation of NLRC4 (Fig 5). Based on the computing analysis of the spatial structure of the NLRC4–VDR association, the prediction indicates Lys123 as the critical amino acid for the formation of the VDR–NLRC4 complex. As Lys residue commonly acts as a ubiquitination site for posttranslational processing, Western blot analysis indicated no difference in the ubiquitination of the two proteins, VDR and VDR (K123A; Fig EV5D). However, the importance of Lys123 for VDR in the regulation of NLRC4 inflammasome activation was demonstrated by in vitro and in vivo assays (Fig 7).

Our previous study reported VDR as a negative NLRP3 oligomerization and activation; in the absence of VDR, NLRP3 inflammasome activation was increased in response to LPS‐induced or alum‐induced peritoneal inflammation (Rao et al, 2019). Similar studies have reported that the VDR agonist exerts an inhibitory effect on NLRP3 inflammasome activation, and vitamin D3 can abolish NLRP3 inflammasome activation and inhibit caspase‐1 activation and IL‐1β secretion via VDR function (Duan et al, 2021). However, in the S. Typhimurium‐induced peritonitis model, our results showed that the IL‐1β production and caspase‐1 cleavage were no significant differences between VDR−/− and NLRP3−/− VDR−/− macrophages, even between NLRP3−/− and WT macrophages, demonstrating macrophages response to S. Typhimurium infection is not NLRP3‐dependent process. In addition, the phosphorylation of NLRC4 at S533 was reported to recruit ASC to activate inflammasome by interacting with NLRP3 (Qu et al, 2016). Here, we found that VDR does not affect NLRC4 phosphorylation, further confirming that the regulation of VDR on NLRC4 inflammasome activation is independent of the NLRP3 signal.

Collectively, our findings provide a novel role of VDR in NLRC4 inflammasome activation in response to intracellular bacterial infection. Of note, VDR exerts the opposite effect in two inflammasomes, inhibiting NLRP3 activation but promoting NLRC4 activation. VDR is a vital regulator for host cells responding to pathogenic insults. Insights gained from understanding how the VDR pathway is integrally involved in regulating inflammasome activation may deepen the understanding of the nature of host defense signals in inflammation.

Materials and Methods

VSports在线直播 - Reagents and Tools table

Reagent or resource Source Identifier
Antibodies
Anti‐NLRC4 (human) Cell signaling technology Cat#3724
Anti‐NLRC4 (human & mouse) EMD Millipore Cat#2994846
Anti‐GSDMD Abcam Cat#ab209845
Anti‐p‐NLRC4 (Ser533) ECM Biosciences Cat#5411
Anti‐HA Cell signaling technology Cat#3724
Anti‐Myc Thermo Fisher Cat# MA1‐980
Anti‐Myc Proteintech Cat# 10828‐1‐AP
Anti‐Flag Sigma Cat# F1804
Anti‐NLRP3/NALP3 AdipoGen Cat# AG‐20B‐0014
Anti‐VDR Santa Cruz Cat# sc‐13133
Anti‐VDR Proteintech Cat#14526‐1‐AP
Anti‐β‐actin Santa Cruz Cat# sc‐47778
Anti‐Caspase‐1 (mouse) AdipoGen Cat# AG‐20B‐0044
Anti‐ASC AdipoGen Cat# sc‐514414
Anti‐IL‐1β R&D Systems Cat# AF‐401‐NA
Bacterial and virus strains
Salmonella Typhimurium SL1344 ATCC 14028
Experimental models: cell lines
HEK HEK293T cell ATCC CRL‐11268
THP1 cell ATCC TIB‐202
Critical commercial assays
TNF ELISA kit BD Biosciences Cat#558534
Mouse IL‐1β ELISA kit BD Biosciences Cat#559603
TMB substrate reagent set BD Biosciences Cat#555214
Mouse IL‐18 ELISA kit Mlbio Cat#CK‐E 20173
LDH cytotoxicity detection kit Beyotime Cat#C0017
Experimental models: organisms/strains
Mouse: Nlrp3−/− Dr. Shuo Yang N/A
Mouse: Vdr−/− The Jackson Laboratory JAX:017969
Mouse: Lys2‐Cre The Jackson Laboratory Stock No:004781
Nlrc4−/− Dr. Feng Shao N/A
Vdrflox/flox Beijing Biocytogen N/A
Recombinant DNA
HA‐ASC Professor Paul N. Moynagh (National University of Ireland Maynooth, Ireland) N/A
pCMV‐HA‐VDR This paper N/A
pCMV‐HA‐VDR‐C terminal This paper N/A
pCMV‐HA‐VDR‐N terminal This paper N/A
pcNDA3.1‐Flag‐VDR This paper N/A
pcNDA3.1‐Flag‐VDR‐C terminal This paper N/A
pcNDA3.1‐Flag‐VDR‐N terminal This paper N/A
Pgex6p1‐GST‐VDR This paper N/A
pcDNA3.3‐Myc‐NLRC4 This paper N/A
pcDNA3.3‐Myc‐CARD This paper N/A
pcDNA3.3‐Myc‐NACHT This paper N/A
pcDNA3.3‐Myc‐LRR This paper N/A
Pet28a‐His‐NLRC4 This paper N/A
Myc‐PrgJ Dr. Feng Shao (NIBS) N/A
Myc‐Flagellin Dr. Feng Shao (NIBS) N/A
HA‐NAIP2 Dr. Feng Shao (NIBS) N/A
HA‐NAIP5 Dr. Feng Shao (NIBS) N/A
PET28‐Lfn‐ Flagellin Dr. Feng Shao (NIBS) N/A
PET28‐Lfn‐PrgJ Dr. Feng Shao (NIBS) N/A
PET28‐ anthrax‐protective antigen Dr. Feng Shao (NIBS) N/A
Flag‐NLRC4 Dr. Feng Shao (NIBS) N/A
Oligonucleotides

Primer for mouse Naip2:

Forwerd: CCAAAATCATCTGTGCCCAA;

Reverse: ATGCCCCTGACCTTGTTTGT

 This paper N/A

Primer for mouse Naip5:

Forward: CTGCTCACCTTTCCCCTTTA;

Reverse: GGTCTTTAGTCGTTTGGCTTC

 This paper N/A

Primer for mouse Nlrc4:

Forward: TATGACCGAAGACAGTGCCA;

Reverse: TGTATCAGGAGGTCGTAGAAGG

 This paper N/A

Primer for ShRNA‐hVdr:

Forward:GATCCCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTTC

Reverse:TCGAGAAAAACCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGG

 This paper N/A
Open in a new tab

"V体育ios版" Methods and Protocols

Study design

This study evaluated the protective effect of VDR on Salmonella infection and explored the mechanism by which VDR affects NLRC4 inflammasome activation. The effect of VDR on activation of the NLRC4 inflammasome in mouse BMDMs and the underlying mechanism of action were studied using immunoblotting, enzyme‐linked immunosorbent assay (ELISA), co‐immunoprecipitation, pull‐down assay, and retroviral rescue assay. We also evaluated the protective effect of VDR against Salmonella infection in a Salmonella intraperitoneal injection model.

Mice

Vdrflox/flox mice were generated by (Beijing Biocytogen, China).Vdr−/− C57BL/6 mice were obtained from the Jackson Laboratory. Nlrp3−/− mice and Lyz2‐Cre were gifts from Dr. Shuo Yang (Nanjing Medical University, China). Nlrc4−/− mice were a gift from Dr. Shao Feng (NIBS). The Institutional Animal Care and Use Committee of Nanjing Medical University approved the animal experiments. The mice used were 6–8 weeks of age. All mice were bred in the Animal Core Facility of Nanjing Medical University.

Reagent

PolyJet™ DNA transfection Reagent (SL100688) was purchased from SignaGen (USA). Hieff Trans™ Liposomal Transfection Reagent (40802ES02) was purchased from Yeasen Biotechnology Co., LTD (China). A Plasmid DNA Miniextraction kit (DC201‐01) was purchased from Nanjing Vazyme Biotechnology Co., LTD (China). His tag Protein Purification Kit (P2226) was purchased from Beyotime (China) Anti‐VDR (1:1,000, sc‐13133) and Anti‐β‐actin (1:1,000, sc‐47778) were purchased from Santa Cruz Biotechnology (Delaware, USA). TNF ELISA kit (Cat#558534), Mouse IL‐1β ELISA kit (Cat#559603), TMB Substrate Reagent Set (Cat#555214) were purchased from BD Biosciences (State of New Jersey, USA). Mouse IL‐18 ELISA kit (Cat# CK‐E 20173) were purchased from Mlbio (Shanghai, China). Anti‐NLRP3/NALP3 (1:1,000, Cat# AG‐20B‐0014), Anti‐Caspase‐1 (mouse; 1:1,000, Cat# AG‐20B‐0044), Anti‐ASC (1:1,000, Cat# sc‐514414), were purchased from AdipoGen (USA). Anti‐NLRC4 (human; 1:1,000) and Anti‐HA (1:1,000, Cat#3724) were purchased from Cell signaling technology (Massachusetts, USA). Anti‐p‐NLRC4 (Ser533; 1:1,000, Cat#5411) and Anti‐NLRC4 (human & mouse; 1:1,000, Cat#2994846) were purchased from ECM Biosciences (USA). Anti‐GSDMD (1:1,000, ab109845) were purchased from Abcam (UK). Anti‐Myc (1:1,000, Cat# MA1‐980) and Anti‐Flag (1:1,000, Cat# F1804) were purchased from Sigma‐Aldrich (Jefferson City, USA). Anti‐IL‐1β (1:1,000, Cat# AF‐401‐NA) were purchased from R&D Systems (Minnesota, USA).

Plasmids

CMV‐HA‐vector and pcNDA3.1‐Flag‐vector is kept by our laboratory. CMV‐HA‐VDR, pCMV‐HA‐VDR‐C terminal, pCMV‐HA‐VDR‐N terminal, pcNDA3.1‐Flag‐VDR, pcNDA3.1‐Flag‐VDR‐C terminal, pcNDA3.1‐Flag‐VDR‐N terminal, Pgex6p1‐GST‐VDR, pcDNA3.3‐Myc‐NLRC4, pcDNA3.3‐Myc‐CARD, pcDNA3.3‐Myc‐NACHT, pcDNA3.3‐Myc‐LRR, Pet28a‐His‐NLRC4 were constructed by our laboratory. Myc‐PrgJ, MYC‐Flagellin, HA‐NAIP2, HA‐NAIP5, FLAG‐NLRC4, pet28‐LFN‐FLIC, pet28‐LFN‐PrgJ are gifts from Shao Feng Laboratory, Beijing Academy of Life Sciences.

Cell culture

HEK293T cell (CRL‐11268) and THP1 cell (TIB‐202) were purchased from ATCC. Primary bone‐marrow‐derived macrophages were isolated from the bone marrow of mice aged 8 weeks and cultured in DMEM supplemented with 1% penicillin/streptomycin, 10% FBS, and 10% (v/v) conditioned medium from L929 mouse fibroblasts for 5–7 days. HEKHEK293T cells were frozen in liquid nitrogen, resuscitated, and cultured in a cell incubator containing 5% CO2 and 95% air at 37°C. For the NLRC4 inflammasome activation assay, 1 × 106 cells were plated in 12‐well plates overnight. Then, the cells were stimulated with PBS (mock) and S. Typhimurium (MOI = 10 or MOU = 50) for 2 h.

Bacterial culture

Salmonella Typhimurium strain SL1344 is a gift from Professor Liu Xingyin's lab, Nanjing Medical University. Salmonella Typhimurium strain SL1344 was inoculated into Luria‐Bertani (LB) broth and incubated overnight under aerobic conditions at 37°C. Then subcultured it (1:50) for 3 h at 37°C in fresh LB broth to generate bacteria grown to log phase.

Protein purification

Plasmid PET28‐Lfn‐Flagellin, PET28‐Lfn‐PrgJ, and PET28 ‐ anthrax‐protective antigen (gifts from Dr. Shao Feng (NIBS)) were transformed into Escherichia coli strain BL21, respectively, and cultured overnight at 37°C. Single clones were selected into liquid LB medium and shaken overnight at 37°C. The bacterial solution was inoculated into mass LB at a ratio of 1:100 and cultured at 37°C. When OD600 reached 0.5–0.7, 0.5 mM IPTG was added to the bacterial solution, and the expression was induced at 22°C for 12 h. Thallus was collected by centrifugation at 1,503g for 20 min at 4°C. After ultrasonic lysis, the purified protein was obtained according to the instructions of His tag Protein Purification Kit.

Inflammasome activation

LPS (500 ng/ml) was administered for 4 h and Nigricin (5 mM) for 45 min to stimulate NLRP3 inflammasome activation. Salmonella was injected intraperitoneally into mice or added directly to cells to activate the NLRC4 inflammasome. The purified protein (FLIC/PrgJ) is transfected into bone marrow macrophages to activate the NLRC4 inflammasome by following the transfection reagent instructions (40802ES02).

ASC oligomerization assay

BMDM Cells were plated on 12‐well plates and stimulated as indicated. Then washed, the cells three times with PBS and lysed them in PBS containing 0.5% Triton X‐100 for 30 min at 4°C and centrifuged the cell lysates at 8,000 × g for 15 min at 4°C. The pellets soluble in Triton X‐100 were washed twice with PBS and suspended in 200 μl of PBS, then cross‐linked for 30 min by adding fresh disuccinimidyl suberate (2 mM) at room temperature. The cross‐linked pellets were centrifuged at 8,000 × g for 15 min and lysed in protein loading buffer for Western blot analysis.

ELISA and LDH cytotoxicity assay

According to the manufacturer's instructions, Il‐1 β, IL‐18, and TNF‐α concentrations in cell supernatant or mouse serum was measured by ELISA kits. LDH releases were measured by the LDH cytotoxicity detection kit (Beyotime) indicated according to the manufacturer's instructions.

Western blot

Protein lysates obtained from cell or tissue lysis were separated in a running buffer using either 10 or 12% SDS‐PAGE gel and transferred to a PVDF membrane using a wet transfer system. These membranes were blocked in 5% skim milk in Tris‐buffered with saline Twine (TBST) at room temperature for 1 h. After that, these membranes were incubated with primary antibodies.

Co‐immunoprecipitation

The cells were lysed with RIPA cell lysate containing 1% protease inhibitor PMSF. The lysate was centrifuged at 13,523g at 4°C for 10 min. Protein content was measured by one‐drop instrument, and the protein content was consistent. After the antibody was added and slowly rotated overnight at 4°C, protein A/G magnetic beads were used to precipitate the immune complex. The beads were then washed three times with 1× PBST (containing 1%Triton 100) to remove antigen nonspecific binding. The IP sample was resuspended with 1× loading buffer and boiled at 95°C for 5 min.

GST pull‐down assay

The recombinant plasmid containing VDR and NLRC4 was transformed into E. coli BL21‐CodonPlus (DE3) cells. The expression of the recombinant protein GST‐VDR was induced by 0.1 mM isopropyl β‐D‐1‐thiogalactopyranoside (IPTG) for 12 h at 20°C; 0.5 mM IPTG induced the His‐NLRC4 for 14 h at 20°C. Then follow the instructions provided by GST‐labeled protein purification kit or His‐labeled protein purification kit (Beyotime Biotechnology) for purification. After the purified protein was incubated in the same centrifuge tube overnight, GST/HIS antibody was added to form an immune complex with the protein. Protein A/G magnetic beads were used to precipitate the immune complex. The beads were then washed three times with 1× PBST (containing 1%Triton 100) to remove antigen nonspecific binding. The IP sample was resuspended with 1× loading buffer and boiled at 95°C for 5 min.

Retroviral rescue assay

Murine Vdr and VDRK123A were sub‐cloned into the pHBLV‐CMV‐MCS‐3XFlag‐GFP‐PURO lentivirus vector. A lentivirus‐containing medium was obtained from Hanbio. Vdr‐deficient BMDMs were plated in 12‐well plates on the first day, then lentivirus containing the Vdr, VDRK123A, or empty vector was incubated with BMDMs (MOI = 50) at 37°C for 4 h. Then, the medium was replaced, and the cells were incubated for another 48 h. The cell lysates were analyzed by immunoblot.

Animal infection and survival analysis

To test Salmonella‐induced survival in mice, each mouse was intraperitoneally injected with 102 CFU S. Typhimurium. The death time and the number of mice were observed and analyzed. To detect NLRC4 inflammatory cytokine secretion caused by acute Salmonella infection, serum samples were collected 24 h after intraperitoneal injection of 104CFU S. Typhimurium per mouse.

Detection of Salmonella Typhimurium load

Prepare LB solid plate without any resistance in advance. The mice's spleen and other related organs were collected, weighed, and then placed in a 1.5‐ml tube containing 1 ml sterile PBS buffer solution for tissue grinding (2–5 min at 60 Hz). Diluted the homogenate obtained by grinding according to gradient dilution method, and took 200 μl of mixture diluted 103–104 times. The plates were incubated a 37°C overnight. After about 14–16 h, the LB plate was taken out for taking photographs and counting. Mice were injected intraperitoneally with 102 CFU S. Typhimurium for survival analysis in 200 μl PBS. The death time and the number of mice were observed and analyzed.

Immunofluorescence staining

For ASC speck analysis, BMDMs were plated on coverslips. The cells were fixed with a paraformaldehyde stationary solution (Service) for 15–20 min and then permeabilized with 0.2% NP‐40 for 10–15 min. Incubated them with anti‐rabbit ASC antibody (1:200) overnight at 4°C, then incubated with anti‐rabbit Cy3‐conjugated AffiniPure (Jackson Immuno Research). Nuclei were stained by DAPI (Sigma). For co‐localization analysis, HEKHEK293T cells transfected with plasmids encoding Flag‐VDR and Myc‐NLRC4 were cultured for 18–24 h. Then incubated with anti‐Flag and anti‐Myc antibodies (1:100) overnight at 4°C and incubated with fluorescent secondary antibody at room temperature for 1–2 h. The immunofluorescence staining experiment was examined by fluorescence microscopy (BX3, Olympus, Japan).

Predicted the critical binding site of VDR in the formation of the VDR–NLRC4 complex

The three‐dimensional (3D) structure of the active state of NLRC4 (ΔCARD; PDB: 3JBL) is obtained from PDB (Protein Data Bank), and the structure was optimized in MOE2019.01 through energy minimization. The homology modeling of mouse VDR C‐domain was predicted by the Swiss‐Model server (https://swissmodel.expasy.org) with the X‐ray crystal structure of rat VDR (PDB code 1RKG, 97% identify) as the template (Vanhooke et al, 2004). The probable interaction mode of VDR–NLRC4 is explored by protein–protein docking by Molecular Operating Environment (MOE 2019.01) software with default parameters.

Statistical analyses

All data in this study were processed by GraphPad Prism 7 software. The comparison between groups was performed by t‐test, and one‐way ANOVA was performed to compare three or more groups. A P‐value < 0.05 can be considered a statistical difference.

Author contributions

Xin Chen: Conceptualization; data curation. Zaikui Zhang: Data curation. Naishuang Sun: Data curation. Jinzhou Li: Data curation. Zemeng Ma: Data curation. Zebing Rao: Data curation. Xiaomeng Sun Data curation. Qiang Zeng: Formal analysis. Yuxuan Wu: Formal analysis. Jiahuang Li: Formal analysis. Jing Zhang: Data curation; Formal analysis. Yunzi Chen: Conceptualization; resources; data curation; software; formal analysis; supervision; funding acquisition; validation; investigation; visualization; methodology; writing—original draft; project administration; writing—review and editing.

In addition to the CRediT author contributions listed above, the contributions in detail are:

YC, XC, ZZ, and JZ designed the research, analyzed data, and wrote the paper. ZR, NS, JL, ZM, XS QZ, and YW provided research reagents and technical assistance. JZ and JL assisted in data analysis and manuscript preparation. YC was responsible for the overall research design, data analysis, and paper preparation.

Disclosure and competing interests statement (V体育平台登录)

The authors declare that they have no conflict of interest.

Supporting information

Expanded View Figures PDF

Click here for additional data file. (3.1MB, pdf)

Source Data for Figure 1

Click here for additional data file. (4.3MB, zip)

Source Data for Figure 3

Click here for additional data file. (364.8KB, zip)

Source Data for Figure 7

Click here for additional data file. (5.1MB, zip)

Source Data for Expanded View

Click here for additional data file. (1.9MB, zip)

Review Process File

Click here for additional data file. (116.1KB, pdf)

VSports注册入口 - Acknowledgements

We thank Dr. Feng Shao (NIBS) for providing NLRC4−/− mice and plasmids, We thanks Dr. Shou Yang (Nanjing Medical University, China) for providing NLRP3−/− and Lyz2‐Cre mice. This work was supported by the National Nature Science Foundation of China (NSFC) (81871310, 82171723 and 81371759), the Natural Science Foundation of Jiangsu Higher Education Institutions of China (17KJA310002), the Key Project of a Science and Technology Development Fund from Nanjing Medical University (2017NJMUCX003), the Research Start‐up Fund from Nanjing Medical University (2014RC02) to YC.

EMBO reports (2022) 23: e54611

[Correction added on July 21st 2022, after first online publication: deleted “the” in Heading]

Contributor Information

Jiahuang Li, Email: lijiah@qiuluzeuv.cn.

Jing Zhang, Email: jzhang08@qiuluzeuv.cn.

Yunzi Chen, Email: chenyunzi@qiuluzeuv.cn.

Data availability

This study includes no data deposited in external repositories.

References

  1. Bauer R, Rauch I (2020) The NAIP/NLRC4 inflammasome in infection and pathology. Mol Aspects Med 76: 100863 [DOI] [PubMed] [Google Scholar]
  2. Broz P, Newton K, Lamkanfi M, Mariathasan S, Dixit VM, Monack DM (2010) Redundant roles for inflammasome receptors NLRP3 and NLRC4 in host defense against Salmonella. J Exp Med 207: 1745–1755 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Carlberg C (2019) Vitamin D signaling in the context of innate immunity: focus on human monocytes. Front Immunol 10: 2211 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Duan A, Ma Z, Liu W, Shen K, Zhou H, Wang S, Kong R, Shao Y, Chen Y, Guo W et al (2021) 1,25‐Dihydroxyvitamin D inhibits osteoarthritis by modulating interaction between vitamin D receptor and NLRP3 in macrophages. J Inflamm Res 14: 6523–6542 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  5. Duncan JA, Canna SW (2018) The NLRC4 inflammasome. Immunol Rev 281: 115–123 ["V体育平台登录" DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Gatti D, Idolazzi L, Fassio A (2016) Vitamin D: not just bone, but also immunity. Minerva Med 107: 452–460 ["VSports注册入口" PubMed] [Google Scholar]
  7. Gong YN, Shao F (2012) Sensing bacterial infections by NAIP receptors in NLRC4 inflammasome activation. Protein Cell 3: 98–105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Gram AM, Wright JA, Pickering RJ, Lam NL, Booty LM, Webster SJ, Bryant CE (2021) Salmonella flagellin activates NAIP/NLRC4 and canonical NLRP3 inflammasomes in human macrophages. J Immunol 206: 631–640 ["V体育官网" DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ismailova A, White JH (2021) Vitamin D, infections and immunity. Rev Endocr Metab Disord 23: 265–277 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Kim DH, Klemp A, Salazar G, Hwang HS, Yeh M, Panton LB, Kim JS (2020) High‐dose vitamin D administration and resistance exercise training attenuate the progression of obesity and improve skeletal muscle function in obese p62‐deficient mice. Nutr Res 84: 14–24 [DOI (V体育安卓版)] [PubMed] [Google Scholar]
  11. Lage SL, Longo C, Branco LM, da Costa TB, Buzzo Cde L, Bortoluci KR (2014) Emerging concepts about NAIP/NLRC4 inflammasomes. Front Immunol 5: 309 ["V体育平台登录" DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Liu W, Chen Y, Golan MA, Annunziata ML, Du J, Dougherty U, Kong J, Musch M, Huang Y, Pekow J et al (2013) Intestinal epithelial vitamin D receptor signaling inhibits experimental colitis. J Clin Invest 123: 3983–3996 ["V体育ios版" DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Liu W, Liu X, Li Y, Zhao J, Liu Z, Hu Z, Wang Y, Yao Y, Miller AW, Su B et al (2017) LRRK2 promotes the activation of NLRC4 inflammasome during Salmonella Typhimurium infection. J Exp Med 214: 3051–3066 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Madanchi M, Fagagnini S, Fournier N, Biedermann L, Zeitz J, Battegay E, Zimmerli L, Vavricka SR, Rogler G, Scharl M et al (2018) The relevance of vitamin and iron deficiency in patients with inflammatory bowel diseases in patients of the Swiss IBD cohort. Inflamm Bowel Dis 24: 1768–1779 [DOI] [PubMed] [Google Scholar]
  15. Pappa H (2014) Vitamin D deficiency and supplementation in patients with IBD. Gastroenterol Hepatol 10: 127–129 [PMC free article] [PubMed] [Google Scholar]
  16. Qu Y, Misaghi S, Newton K, Maltzman A, Izrael‐Tomasevic A, Arnott D, Dixit VM (2016) NLRP3 recruitment by NLRC4 during Salmonella infection. J Exp Med 213: 877–885 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Rao Z, Chen X, Wu J, Xiao M, Zhang J, Wang B, Fang L, Zhang H, Wang X, Yang S et al (2019) Vitamin D receptor inhibits NLRP3 activation by impeding its BRCC3‐mediated deubiquitination. Front Immunol 10: 2783 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Sundaram B, Kanneganti TD (2021) Advances in understanding activation and function of the NLRC4 inflammasome. Int J Mol Sci 22: 1048 ["VSports app下载" DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Tenthorey JL, Kofoed EM, Daugherty MD, Malik HS, Vance RE (2014) Molecular basis for specific recognition of bacterial ligands by NAIP/NLRC4 inflammasomes. Mol Cell 54: 17–29 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Vance RE (2015) The NAIP/NLRC4 inflammasomes. Curr Opin Immunol 32: 84–89 [VSports手机版 - DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Vanhooke JL, Benning MM, Bauer CB, Pike JW, DeLuca HF (2004) Molecular structure of the rat vitamin D receptor ligand binding domain complexed with 2‐carbon‐substituted vitamin D3 hormone analogues and a LXXLL‐containing coactivator peptide. Biochemistry 43: 4101–4110 [DOI] [PubMed] [Google Scholar]
  22. Wu S, Liao AP, Xia Y, Li YC, Li JD, Sartor RB, Sun J (2010) Vitamin D receptor negatively regulates bacterial‐stimulated NF‐kappaB activity in intestine. Am J Pathol 177: 686–697 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Zhang L, Chen S, Ruan J, Wu J, Tong AB, Yin Q, Li Y, David L, Lu A, Wang WL et al (2015) Cryo‐EM structure of the activated NAIP2‐NLRC4 inflammasome reveals nucleated polymerization. Science 350: 404–409 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Zhao Y, Shao F (2015) The NAIP‐NLRC4 inflammasome in innate immune detection of bacterial flagellin and type III secretion apparatus. Immunol Rev 265: 85–102 [DOI] [PubMed] [Google Scholar]
  25. Zhao Y, Yang J, Shi J, Gong YN, Lu Q, Xu H, Liu L, Shao F (2011) The NLRC4 inflammasome receptors for bacterial flagellin and type III secretion apparatus. Nature 477: 596–600 [DOI] [PubMed] [Google Scholar]

Associated Data (V体育2025版)

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Expanded View Figures PDF

Click here for additional data file. (3.1MB, pdf)

Source Data for Figure 1

Click here for additional data file. (4.3MB, zip)

Source Data for Figure 3

Click here for additional data file. (364.8KB, zip)

Source Data for Figure 7

Click here for additional data file. (5.1MB, zip)

Source Data for Expanded View

Click here for additional data file. (1.9MB, zip)

Review Process File

Click here for additional data file. (116.1KB, pdf)

Data Availability Statement

This study includes no data deposited in external repositories.

Articles from EMBO Reports are provided here courtesy of Nature Publishing Group

"VSports注册入口" RESOURCES