Skip to main content (VSports最新版本)
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2015 Jul 1.
Published in final edited form as: Mol Immunol. 2014 Apr 18;60(1):44–53. doi: 10.1016/j.molimm.2014.02.019

,DIVERGENT ROLES OF HISTONE DEACETYLASE 6 (HDAC6) AND HISTONE DEACETYLASE 11 (HDAC11) ON THE TRANSCRIPTIONAL REGULATION OF VSports注册入口 - IL10 IN ANTIGEN PRESENTING CELLS

"VSports在线直播" Fengdong Cheng 1,#, Maritza Lienlaf 1,#, Patricio Perez-Villarroel 1, Hong-Wei Wang 1, Calvin Lee 3,4, VSports - Karrune Woan 1, David Woods 1, Tessa Knox 1, Joel Bergman 5, Javier Pinilla-Ibarz 1, Alan Kozikowski4 (VSports在线直播) 5, Edward Seto 2, Eduardo M Sotomayor 1,**, Alejandro Villagra 1,**
PMCID: PMC4020151  NIHMSID: NIHMS580014  PMID: 24747960

Abstract (VSports手机版)

The anti-inflammatory cytokine IL-10 is a key modulator of immune responses. A better understanding of the regulation of this cytokine offers the possibility of tipping the balance of the immune response toward either tolerance, or enhanced immune responses. Histone deacetylases (HDACs) have been widely described as negative regulators of transcriptional regulation, and in this context, the primarily nuclear protein HDAC11 was shown to repress il-10 gene transcriptional activity in antigen-presenting cells (APCs). Here we report that another HDAC, HDAC6, primarily a cytoplasmic protein, associates with HDAC11 and modulates the expression of IL-10 as a transcriptional activator VSports最新版本. To our knowledge, this is the first demonstration of two different HDACs being recruited to the same gene promoter to dictate divergent transcriptional responses. This dynamic interaction results in dynamic changes in the expression of IL-10 and might help to explain the intrinsic plasticity of the APC to determine T-cell activation versus T-cell tolerance.

"V体育2025版" INTRODUCTION

Antigen presenting cells (APCs) play a central role in the induction of T-cell activation as well as T-cell tolerance(Rabinovich et al. , 2007) V体育平台登录. IL-10, a cytokine with immunosuppressive properties, has been shown to be critical in the generation of APCs with tolerogenic properties(Grütz, 2005; Wakkach et al. , 2003) and in the prevention of self-tissue damage(Li and Flavell, 2008; Murai et al. , 2009; Rubtsov et al. , 2008). As such, a better understanding of the regulation of this cytokine in APCs might unveil novel molecular targets to tip the balance of an immune response towards either tolerance or immune activation.

A major regulatory mechanism for IL-10 production occurs at the transcriptional level, and it is dictated by negative and positive feedback loops involving several transcriptional regulators and signaling pathways that are cell-type specific VSports注册入口. Important transcriptional regulators of IL-10 include STAT3, Sp1, AP-1, NFκB, C/EBPβ, and GATA3(Saraiva and O'Garra, 2010). While some of them are required for transcriptional activation of the IL-10 gene (STAT3, Sp1) others (HDAC11, PU. 1) exert an opposite effect. The molecular mechanism(s) dictating the balance between these divergent pathways remain to be fully elucidated(Saraiva and O'Garra, 2010).

Recent studies have demonstrated that in addition to genetic regulation, epigenetic modifications of specific genes influences the inflammatory status of the APC and T-cell activation versus T-cell tolerance(Medzhitov and Horng, 2009; Woan et al. , 2012). Histone acetyl transferases (HATs) and histone deacetylases (HDACs) mediate chromatin modification by acetylation and deacetylation of histone tails respectively, a well-known mechanism of transcriptional regulation in the inflammatory response(Foster et al. , 2007). Along these lines, important changes in chromatin have been observed during the activation of the IL-10 gene promoter, including acetylation of specific promoter regions(Villagra et al V体育官网入口. , 2009; Zhang et al. , 2006).

HDACs are enzymes that are recruited by co-repressors or by multi-protein transcriptional complexes to gene promoters where they regulate gene expression through chromatin modifications (de Ruijter et al VSports在线直播. , 2003; Yang and Seto, 2008). Recently, by over-expressing or knocking down specific HDACs in murine and human APCs we found that among all the members of this family of enzymes, the primarily nuclear HDAC11(Gao et al. , 2002) is recruited to the IL-10 gene promoter to negatively regulate its expression(Villagra et al. , 2009). Those earlier studies also suggested that another member of this family, HDAC6, which is primarily found in the cytoplasm, might exert an opposite effect to that of HDAC11 upon IL-10 gene transcriptional activity. These divergent effects led us to explore whether a “cross-talk” or interaction might exist between these two HDACs and whether such a putative association might represent a point of convergence of negative and positive feedback loops involved in regulation of IL-10 gene transcriptional activity.

Here we have shown that unlike HDAC11, which is a transcriptional repressor of IL-10, HDAC6 is required for IL-10 gene transcriptional activation of APCs. Furthermore, we have found that these two HDACs physically interact with each other in the cytoplasm and nuclei of APCs. The additional demonstration that IL-10 gene expression is abrogated in the absence of HDAC6, but not rescued upon additional knockdown of HDAC11, points to HDAC6 as the “driver” within this molecular complex V体育2025版. Taken together, our findings not only represent the first demonstration of two different HDACs interacting with the same target to dictate divergent transcriptional responses, but also positions HDAC6 as a novel molecular target to disrupt the anti-inflammatory effects of IL-10 on APCs and tips the balance towards enhanced immune responses.

RESULTS

Genetic disruption of HDAC6 inhibits IL-10 production in macrophages and dendritic cells

In previous studies we have shown that overexpression of HDAC11 in murine and human APCs resulted in decreased IL-10 gene activation in response to LPS stimulation VSports. In contrast, overexpression of HDAC6 was associated with increased IL-10 gene transcriptional activity in the same cells. The opposite manipulation, that is knocking down HDAC11 resulted in increased IL-10 gene transcriptional activity, while knocking down HDAC6 was associated with decreased IL-10 gene activation in response to LPS(Villagra et al. , 2009).

In order to better define the role of HDAC6 in the regulation of IL-10 transcriptional activity, we next examined the production of IL-10 in APCs in which HDAC6 was genetically disrupted. First, by using lentiviral particles carrying specific shRNA for HDAC6, we knocked down HDAC6 in the macrophage cell line RAW264.7 (HDAC6KD). As shown in Fig. 1A, wild type (WT) cells and control cells stably transfected with non-target shRNA (NT) produced equal amounts of IL-10 in response to LPS (Fig. 1A, WT or NT, LPS+). In contrast, HDAC6KD cells were unable to produce this cytokine in response to LPS stimulation (Fig. 1A, HDAC6KD, LPS+). Second, similar results were obtained in peritoneal elicited macrophages (PEM) and dendritic cells (DC) isolated from HDAC6 knock out (HDAC6 KO) mice(Zhang et al., 2008). As shown in Figure 1B, both PEM and DCs devoid of HDAC6 produced significantly less IL-10 in response to LPS as compared to APCs from WT mice. Therefore, in contrast to HDAC11 negatively regulating IL-10 production in APCs(Villagra et al., 2009), HDAC6 seems to exert an opposite effect and is required for IL-10 production by APCs in response to LPS stimulation.

Figure 1. HDAC6 is required for IL-10 production by APCs.

Figure 1

Open in a new tab

(A) RAW264.7 cells were stably transduced with lentiviral particles containing HDAC6-specific shRNA (HDAC6KD) or with non-targeting shRNA control following manufacture's protocol (NT). These cells, as well as wild-type (WT) RAW264.7 were treated with or without LPS (1 μg/ml) for 24 hours. IL-10 production was then determined by ELISA. (B) Peritoneal elicited macrophages (PEM) and bone marrow derived DCs isolated from wild type or HDAC6KO mice were stimulated with LPS (1 μg/ml) in vitro for 24 hours. IL-10 production was then determined by ELISA. Three experiments were performed with similar results. Error bars represent standard deviation from triplicates.

HDAC6 physically interacts with HDAC11 in both the cytoplasmic and nuclear compartments

The differential intracellular localization of HDAC11 and HDAC6, along with the prevalent view that HDAC6 lacks nuclear function(Boyault et al., 2007), made it unlikely that a physical interaction between these HDACs could explain their effects upon IL-10 gene expression in APCs. However, protein extracts from murine RAW264.7 cells and the human promonocytic cell line THP.1 demonstrated that endogenous HDAC6 coimmunoprecipitated with HDAC11 (Fig. 2A). Similarly, endogenous HDAC11 was coimmunoprecipitated by anti-HDAC6 antibody in primary peritoneal macrophages (Fig. 2B). To confirm these findings, we performed confocal microscopy studies to visualize whether HDAC6 and HDAC11 co-localize within intact cells. First, a RAW264.7 cell line over expressing FLAG-HDAC11 was generated to detect the FLAG epitope using an anti-FLAG antibody and a secondary antibody conjugated to the fluorochrome Alexa Fluor 488 (green). As shown in Figure 2C (F-HDAC11 panel), HDAC11 is localized in both the cytoplasm and nuclei. Detection of HDAC6 by using a HDAC6 antibody and a secondary antibody conjugated to the fluorochrome Alexa Fluor 647 (red), demonstrated that this HDAC is localized primarily in the cytoplasm, although some minimal expression was also observed in the nuclei (Fig. 2C, HDAC6 panel). Of note, the merged image shows that HDAC6 and HDAC11 mainly co-localize in the cytoplasm, although some co-localization was also detected in the nucleus (Fig. 2C-Merge)

Figure 2. HDAC6 interacts with HDAC11 in the cytoplasmic and nuclear compartments of APCs.

Figure 2

Open in a new tab

Cell extracts from RAW264.7 or THP.1 cells (A) or from primary peritoneal macrophages (B) were immunoprecipitated (IP) using an anti-HDAC11 or anti-HDAC6 antibody, respectively. The IP fraction was then subjected to WB to evaluate for the presence of HDAC6 or HDAC11 respectively. (C) RAW264.7 cells were stably transfected with a plasmid carrying FLAG-HDAC11 (F-HDAC11). Cells were then analyzed by confocal microscopy with an anti-FLAG antibody and a secondary antibody conjugated to the fluorochrome Alexa Fluor 488 (green). To detect endogenous HDAC6 we used an anti-HDAC6 antibody and a secondary antibody conjugated to the fluorochrome Alexa Fluor 647 (red). Shown is a representative set of pictures from three experiments with similar results. (D) Nuclear and cytoplasmic fractions from macrophages over-expressing FLAG-HDAC11 were subjected to immunoblotting to evaluate the intracellular distribution of HDAC11 and endogenous HDAC6. Immunoblotting of HDAC1 and tubulin were used as controls for nuclear and cytoplasmic fractions respectively. (E) Nuclear and cytoplasmic fractions from macrophages over-expressing FLAG-HDAC11 were immunoprecipitated with an anti-FLAG antibody and the presence of HDAC6 was then evaluated by western blot. Data is from a representative experiment of three independent experiments with similar results.

Finally, in order to further validate the above results, we performed coimmunoprecipitation studies in cytoplasmic (Cyt) and nuclear (Nuc) extracts prepared from FLAG-HDAC11 expressing macrophages. First, immunoblots of these extracts confirmed that HDAC11 is present in both fractions (Fig 2D-top panel). Although HDAC6 was clearly detected in the cytoplasm, a faint band could also be detected in the nuclear fraction (Fig. 2D, αHDAC6). Anti-HDAC1 and anti-tubulin antibodies were used as controls for nuclear and cytoplasmic localization respectively (Fig. 2D, αHDAC1 and αTubulin). We were able to demonstrate that HDAC6 interacts with HDAC11 in both cellular compartments by immunoprecipitating FLAG-HDAC11 in both the cytoplasmic and nuclear fractions (Fig. 2E); providing evidence that HDAC6 and HDAC11 interact with each other in APCs.

The N-terminal domain of HDAC11 and the C-terminal domain of HDAC6 are required for their physical interaction in macrophages

Next, we investigated which domains of HDAC6 and HDAC11 are necessary for their putative physical interaction in vivo. We generated constructs of FLAG-tagged HDAC6 and HDAC11 containing various deletions. For HDAC6 we used two constructs, HD6(1-840) and HD6(1-503), both lacking the C-terminal domain (Figure 3A, top). These truncated and full-length HDAC6 constructs were overexpressed in RAW264.7 cells. Figure 3A (middle) depicts the electrophoretic migration of these HDAC6 proteins on a western blot (WB) probed with FLAG antibody. Immunoprecipitation (IP) with anti-FLAG antibody followed by immunoblot with anti-HDAC11 antibody demonstrates that HDAC11 coimmunoprecipitated with the full-length HDAC6 protein (Fig. 3A bottom, 1-1215), but not with HDAC6 proteins lacking the C-terminal domain (Fig. 3A bottom, 1-840 or 1-503), indicating that this domain is required for its physical interaction with HDAC11.

Figure 3. HDAC6/HDAC11 interaction requires the C-terminus domain of HDAC6 and the N-terminus domain of HDAC11.

Figure 3

Open in a new tab

(A) Constructs of HDAC6 coding for truncated forms of the protein carrying the FLAG epitope (top) were expressed in RAW264.7 cells (middle). Whole cell lysates were then subjected to immunoprecipitation and the presence of HDAC11 was evaluated by western blotting (bottom). (B) Constructs of HDAC11 coding for truncated forms of the protein carrying the FLAG epitope (top) were expressed in RAW264.7 cells (middle). Whole cell lysates were subjected to immunoprecipitation and the presence of HDAC6 was evaluated by western blotting (bottom). Data is from a representative experiment of two independent experiments with similar results.

Conversely, to determine which domain of HDAC11 is required for its interaction with the C-terminal domain of HDAC6, we generated three HDAC11 mutants: HD11(17-321) that lacks both the N- and C-terminal domains, HD11(66-347) that lacks only the N-terminal domain, and HD11(1-264) that lacks only the C-terminal domain (Figure 3B, top). These mutants and full-length FLAG-tagged HDAC11(1-347) constructs were then overexpressed. The anti-FLAG blot in Figure 3B (middle) verified the expression of the expected molecular weight HDAC11 proteins. Immunoprecipitation of these HDAC11 species with anti-FLAG antibody followed by WB with HDAC6 antibody clearly indicated that HDAC6 only coimmunoprecipitated with HDAC11 proteins with an intact N-terminal domain (1-347 and 1-264 in Figure 3B, bottom). In the absence of a N-terminal domain, no HDAC6 coimmunoprecipitated with FLAG-HDAC11 (Fig. 3B bottom, 17-321 and 66-347 constructs), suggesting that the N-terminal domain of HDAC11 is necessary for its interaction with HDAC6.

HDAC6 and HDAC11 are simultaneously recruited to the IL-10 gene promoter

The above data demonstrates that HDAC6 and HDAC11 interact with each other in macrophages. Furthermore, these two HDACs exert an opposite effect upon IL-10 gene expression, with HDAC6 being required for IL-10 production (Fig. 1) and HDAC11 acting as a repressor(Villagra et al., 2009). To better understand the mechanism by which these HDACs regulate IL-10 gene transcriptional activity, we examined whether endogenous HDAC6 and/or HDAC11 are recruited to the IL-10 gene promoter.

Previously we have reported the sequence of chromatin modifications that occur at the level of the IL-10 gene promoter in macrophages stimulated with LPS (Villagra et al., 2009). Briefly, phosphorylation of Ser10 on H3 is an early event that occurs within 30 min after LPS stimulation. This is followed by increased acetylation of H3 and H4, subsequent recruitment of the transcriptional activator STAT3, and, ultimately, IL-10 gene expression. Therefore, we evaluated the kinetics of HDAC6 and HDAC11 recruitment to sequential segments across the IL-10 gene promoter up to 2kb upstream in the gene promoter by chromatin immunoprecipitation (ChIP) analysis. We observed recruitment of HDAC6 and HDAC11 to only two regions of the promoter, assigned arbitrarily as proximal (−87 to −7) and distal (−1322 to −1223) regions. Analysis of the proximal region revealed that acetylation of H3 peaked at 30 minutes followed by a progressive decline by 2 hours and a return to baseline by 7 hours after LPS stimulation (Figure 4A). Analysis of the kinetics of HDAC6 recruitment to the IL-10 gene promoter has shown that its recruitment started within the first hour and achieved a first peak by 2 hours. This was followed by a slight decrease at 3 hours and a second (maximum) peak at 5 hours post-stimulation (Figure 4B). The recruitment of HDAC11 was also observed within one hour, reaching a plateau by 2 hours and returned to baseline levels at 5 hours post-stimulation (Figure 4C). Analysis of the distal IL-10 gene promoter demonstrated that HDAC6 and HDAC11 are also recruited to this region of the gene promoter. Of note, the magnitude in the changes observed are different relative to those observed previously in the proximal region. Although, the kinetics of recruitment seems to be similar to that of HDAC11 having a peak recruitment by two hours and HDAC6 by five hours post LPS-stimulation (Supplemental Fig. 1).

Figure 4. HDAC6 is recruited to the IL10 gene promoter.

Figure 4

Open in a new tab

Macrophages were treated with LPS (1.0 μg/mL), and then harvested at baseline (time 0) or at 0.5, 1, 2, 3, 5 and 7 hours after treatment. Cells were then subjected to ChIP analysis using antibodies against acetylated H3 (A), HDAC11 (B), or HDAC6 (C). Quantitative real time PCR analysis was performed in the region between −87 to −7 of the IL-10 gene promoter. Error bars represent standard deviation from triplicates. Shown is a representative experiment of two independent experiments with similar results. (D) Sequential chromatin immunoprecipitation (co-ChIP) of HDAC6 and HDAC11 on the IL-10 promoter. Data is from a representative experiment of two independent experiments with similar results.

The findings that HDAC6 and HDAC11 were both recruited to the IL-10 gene promoter led us to explore whether they might be recruited to the same DNA sequence within the promoter. We therefore performed co-chromatin immunoprecipitation (co-ChIP) for HDAC6 and HDAC11. Co-ChIP is a two-step sequential chromatin immunoprecipitation, where the first antibody is directed against HDAC11 and the second antibody against HDAC6, and vice-versa(Villagra et al., 2006). As shown in Figure 4D, both deacetylases were recruited to the IL-10 gene promoter in response to LPS stimulation (black bars, ChIPαHDAC11 and ChIPαHDAC6 respectively). Following this first ChIP, and after proper pre-clearance, samples were subjected to a second immunoprecipitation with antibody against the other HDAC. Regardless of the order of HDAC antibodies, both co-ChIP approaches demonstrated that HDAC11 and HDAC6 are recruited to the same DNA sequence within the IL-10 gene promoter (Fig. 4D, black bars, ChIPαHDAC11, co-ChIP αHDAC6 and ChIPαHDAC6, co-ChIP αHDAC11, respectively). This finding demonstrates a concerted recruitment of HDAC6 and HDAC11 to the same region of the IL-10 gene promoter.

HDAC6, but not HDAC11, is required for transcriptional activation of the VSports最新版本 - IL- 10 gene promoter in APCs

To better define the contribution of these HDACs in regulating IL-10 gene transcriptional activity we next evaluated the chromatin changes in the IL-10 gene promoter when HDAC6, HDAC11, or both are depleted. First, we examined the changes in RAW264.7 cells in which HDAC6 was knocked down. As expected, minimal HDAC6 recruitment to the IL-10 gene promoter in response to LPS was found in HDAC6KD cells as compared to non-target shRNA control cells (Figure 5A, gray bar versus open bar). In the absence of HDAC6, there was a slight increase in HDAC11 recruitment to the IL-10 gene promoter, but this was not significantly different than the levels observed in non-target shRNA control cells (Figure 5B). Notably, in HDAC6KD cells there was a significant decrease in the acetylation of H3 at the level of the IL-10 gene promoter (Figure 5C). A similar decrease in H3 acetylation and HDAC6 recruitment to the IL-10 gene promoter was observed in PEM treated with Tubastatin A, an isotype-selective HDAC6 inhibitor(Kozikowski et al., 2008) (Supplemental Fig. 2A). Reminiscent of our findings in HDAC6KD or HDAC6KO APCs, a decrease in IL-10 mRNA and protein production was also observed in PEM from wild-type mice treated with Tubastatin A in vitro (Supplemental Fig. 2B).

Figure 5. Transcriptional activation of the IL-10 gene requires HDAC6.

Figure 5

Open in a new tab

(A-C) HDAC6KD RAW264.7 cells or non-target shRNA control cells were treated with LPS (1.0 μg/mL) for two hours. Cells were then subjected to ChIP analysis using antibodies against HDAC6, HDAC11, and acetylated H3. Data is from a representative experiment of two independent experiments with similar results. (D) PEM isolated from HDAC11KO or wild-type mice were treated with LPS (1.0 μg/mL) for 2 hours. Then, cells were subjected to ChIP analysis using antibodies against acetylated H3, and HDAC6. (E) PEM from WT or HDAC11KO mice were transiently infected with a lentivirus carrying shRNA specific for HDAC6 and were stimulated with LPS (1.0 μg/ml) for 24 hours. The production of IL-10 protein was then determined by ELISA. Data is from a representative experiment of three independent experiments with similar results.

Previously, we have shown the chromatin modifications that occur at the level of the IL-10 gene promoter in macrophages in which HDAC11 was knocked down(Villagra et al., 2009). In those studies, we did not determine whether HDAC11 manipulation influences the recruitment of HDAC6 to the IL-10 gene promoter. As shown in Figure 5D, primary macrophages isolated from HDAC11KO mice have increased H3 acetylation. However, HDAC6 was still recruited to the IL-10 gene promoter in cells lacking HDAC11.

The above results suggest that in the absence of the other interacting partner, HDAC11 or HDAC6 can still be recruited to the IL-10 gene promoter. However, in HDAC6KD or KO cells in which HDAC11 was present, no IL-10 production was observed in response to LPS (Fig. 1), whereas in HDAC11 KD or KO cells in which HDAC6 is present, an enhanced IL-10 production was observed(Villagra et al., 2009). We therefore hypothesized that if HDAC6 is the “driver” for IL-10 production within this molecular complex, knocking down HDAC6 should abrogate the enhancement in IL-10 production in macrophages already lacking HDAC11.. Figure 5E shows the LPS-induction of IL-10 production by primary macrophages and those lacking each or both HDACs. Unlike wild-type cells (white bar), HDAC6KD (gray bar) do not produce IL-10 in response to LPS. In sharp contrast, macrophages lacking HDAC11 display an enhanced production of IL-10 in response to LPS (black bar). However, this enhancement was no longer present in macrophages lacking both HDAC11 and HDAC6, indicating that the transcriptional activation of the IL-10 promoter that occurs in the absence of HDAC11 is dependent upon the presence of HDAC6.

"VSports手机版" DISCUSSION

In this study we have clearly established that HDAC6 associates with HDAC11 to tightly control IL-10 production by APCs. Prior studies have shown that HDAC11 and HDAC6 can interact at the same time with the Vitamin D3 Receptor (VDR) to regulate the expression of MYC(Toropainen et al., 2010). Furthermore, by over-expressing FLAG-tagged versions of HDAC11 in 293 cells, Gao et al. has shown that HDAC6 can be co-immunoprecipitated with FLAG-HDAC11(Gao et al., 2002). However, our study is the first to demonstrate that endogenous HDAC6 and HDAC11 physically interact with each other in the cytoplasm and nuclei of APCs and are recruited to the IL-10 gene promoter to regulate its transcriptional activity.

The relevance of our discovery lies on several levels. First, unlike HDAC11 which is a transcriptional repressor of IL-10, HDAC6 is required for the transcriptional activation of IL-10 gene expression in macrophages and dendritic cells (DCs). Second, these two HDACs with opposite effects upon IL-10 expression physically interact with each other in the APC. Third, our demonstration that HDAC6 and HDAC11 elicit opposite effects upon IL-10 gene expression is the first evidence that two different HDACs can interact with the same target to dictate divergent transcriptional responses in APCs. Finally, the additional demonstration that IL-10 gene expression is abrogated in the absence of HDAC6, but not rescued upon additional knockdown of HDAC11, points to HDAC6 as the “driver” within this regulatory complex. HDAC6 therefore represents a novel molecular target to disrupt the anti-inflammatory effects of IL-10 in the APC and tips the balance towards an enhanced immune response. Supporting our findings, we have also shown that treatment of macrophages with the HDAC6 selective inhibitor Tubastatin A decreases IL-10 mRNA and protein production by these cells. Furthermore, we have recently found that Tubastatin A-treated APCs are better activators of antigen-specific T-cells in both in vitro and in vivo studies (publication submitted).

HDAC6 is a 131KDa protein predominantly found in the cytoplasm where it regulates the acetylation of multiple proteins, including tubulin, Hsp90, and cortactin(Valenzuela-Fernández et al., 2008). HDAC6 has been primarily recognized as a key regulator of cytoskeleton, cell migration and cell-cell interactions (Aldana-Masangkay and Sakamoto, 2010). However, emerging evidence also implicates this protein in the regulation of immune responses, in particular at the level of the APC/T-cell immune synapse(Serrador et al., 2004) and in the suppressive function of regulatory T-cells(de Zoeten et al., 2011). Although these functions of HDAC6 may not be exclusively due to the deacetylation of histones, it has been named according to its homology to other HDACs and its weak ability to deacetylase histones in in vitro assays(Todd et al.). Here, we have expanded upon the previously described properties of HDAC6 showing that it forms a protein complex with HDAC11 that is detected in both the cytoplasm and nuclear compartments. This interaction is mediated by the carboxyterminus of HDAC6 and the aminoterminus of HDAC11. In response to LPS stimulation, HDAC6 and HDAC11 are both recruited to the same DNA sequence within the IL-10 gene promoter, an effect that occurs within the first 2 hours of LPS stimulation. However, 5 hours after LPS stimulation, a divergent outcome is observed with HDAC6 being retained at the promoter region and HDAC11 disappears from the surrounding chromatin. Notably, individual knockdowns of HDAC6 or HDAC11 demonstrated that each deacetylase can still be recruited to the IL-10 gene promoter without its interacting partner, suggesting that their nuclear translocation might be independently controlled, perhaps by transcription factors involved in IL-10 gene regulation.

HDACs are widely known as potent negative regulators of transcription. Therefore, we are left to explain the unexpected role of HDAC6 as a transcriptional activator of IL-10. Since HDAC6 has minimal effects on histone deacetylation, it is plausible that the observed outcome might be due to the effects of HDAC6 over nonchromatin transcriptional regulators. For instance, HDAC6 might be an active member of the local chromatin composition of the IL-10 gene promoter via the deacetylation of transcriptional regulators of IL-10. We are currently exploring whether the several known transcriptional regulators of IL-10 may be putative targets of HDAC6.

In summary, we have unveiled a previously unknown mechanism for the transcriptional regulation of IL-10 that involves HDAC6 and HDAC11. Their dynamic interaction and the dynamic changes in the expression of IL-10 might explain the intrinsic plasticity of the APC in determining T-cell activation versus T-cell tolerance, a critical decision with important implications in autoimmunity, cancer immunotherapy and transplantation fields.

METHODS

VSports注册入口 - Mice

Male BALB/c or C57BL/6 mice (6- to 8-weeks old) were obtained from the National Institutes of Health (Frederick, MD). HDAC6 KO mice (H-2b) were kindly provided by Dr. P. Matthias(Zhang et al., 2008) (Friedrich Miescher Institute for Biomedical Research, Basel, Switzerland). HDAC11KO mice were provided by Dr. Edward Seto (H. Lee Moffitt, Tampa, FL). Experiments involving the use of mice were performed in accordance with protocols approved by the Animal Care and Use Committee of the University Of South Florida College Of Medicine.

Cell lines

The macrophage cell line RAW264.7 and THP1 cells have been described previously(Vicente-Suarez et al., 2007; Villagra et al., 2009). Cells were cultured in vitro in RPMI 1640 media, supplemented with 10% FCS, penicillin/streptomycin (50 U/ml), L-glutamine (2 mM), and β-mercaptoethanol (50 μM), and grown at 37 °C and 5% CO2.

Isolation of macrophages and dendritic cells

C57BL/6 (H-2b), HDAC11KO (H-2b) or HDAC6 KO (H-2b) mice were injected intraperitoneally (ip) with 1 mL of thioglycollate (DIFCO Laboratories, Detroit, MI). Four days later, peritoneal elicited macrophages (PEM) were isolated by peritoneal lavage as previously described(Sotomayor et al., 1991). Dendritic cells (DCs) were generated from murine bone marrow using RPMI 1640 medium supplemented with 10%FCS, 20 ng/ml murine recombinant GM-CSF, and 10 ng/ml IL-4 (both from RDI, Flanders, NJ). The cultures were maintained at 37°C in 5% CO2 humidified atmosphere. On day 3 of culture, floating cells were gently removed and fresh medium with cytokines was replaced. On day 5, cells were collected and DCs were enriched by centrifugation on metrizamide gradient (Accurate Chemicals, Westbury, NY).

Reagents

LPS (Escherichia coli 055:B5, catalog number L-2880) and shRNA lentiviral particles were purchased from Sigma-Aldrich (St. Louis, MO). Lipofectamine 2000 and Lipofectamine LTX were from Invitrogen (Carlsbad, CA). HDAC6 mutants were kindly provided by Dr. Zhang's lab at University of South Florida(Zhang et al., 2007) and HDAC11 mutants were generated in Dr. E. Seto's lab (Glozak and Seto, 2009).

Antibodies and Immunoblotting

Anti-HDAC6 (C0226) antibody was purchased from Assay Biotech. Anti-FLAG (F1804) antibody was from Sigma. Anti-GAPDH (sc-25778), anti-Tubulin (sc-32293), anti-HDAC1 (sc-7872) and anti-acetylated tubulin (sc-23950) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-acetylated H3 (06-599) antibody was purchased from Millipore (Billerica, MA). Three different antibodies against HDAC11 were used; ab47036 from ABCAM (Cambridge, MA), ab3611 from Biovision (Milpitas, CA) for immunoblot and abH4539 from Sigma for ChIP analysis.

Overexpression and knocking-down experiments

shRNA lentiviral transduction particles for murine HDAC11 (NM144919, TRCN0000039224), murine HDAC6 (NM010413, TRCN0000008415), and non-target shRNA (SHC002V) were all from Sigma. Sequences for their respective targets are available from the company. For transduction of lentiviral particles for shRNA HDAC6 and HDAC11, we followed the protocol provided by the manufacturer using a final MOI of 75. Lentiviral particles for the non-target control were a single random sequence not present in the human or mouse genome. All assays were carried out in triplicate, and western blots were performed to evaluate protein expression.

The over-expression of full length mutants for HDAC6 and HDAC11 were performed in macrophages RAW264.7 cells transfected with plasmids encoding for FLAG-tagged version of the respective proteins. Forty-eight hours later, cells expressing each protein variant were lysed and the respective recombinant proteins purified by anti-FLAG affinity columns. Cell extracts isolated from PEM or BMDM were incubated with the FLAG-tagged proteins previously purified. Protein complexes were immunoprecipitated using anti-FLAG–agarose beads (Sigma A-2220). Immune complexes were eluted using 200 μg/ml FLAG peptide (Sigma F-3290) in whole-cell extract buffer and analyzed by immunoblot.

"VSports最新版本" Confocal studies

RAW264.7 cells were subjected to immunofluorescent staining using primary antibodies against HDAC6 (1:200) and FLAG (1:25), secondary antibodies Alexa Fluor 488 donkey anti-mouse IgG (1:200) and Alexa Fluor 594 donkey anti-rabbit IgG (1:200), respectively. Samples were viewed with a Leica DMI6000 inverted microscope, TCS SP5 confocal scanner, and a 63X/1.40NA Plan Apochromat oil immersion objective (Leica Microsystems GmbH, Wetzlar, Germany). 405 Diode, Argon, and HeNe 594 laser lines were applied to excite the samples and a tunable AOBS was adjusted to minimize crosstalk between fluorochrome emissions. Gain, offset, and pinhole settings were identical for all samples within the treatment group. Images were captured with photomultiplier detectors and prepared with the LAS AF software version 2.5.0 (Leica Microsystems GmbH, Wetzlar, Germany).

Quantitative Real time (qRT)-PCR analysis

Macrophage cell line, primary murine macrophages or DCs were plated at 2×106 cells per 35mm well and cultured under conditions detailed under each experiment. Total RNA was extracted using TriZol reagent (Invitrogen, NY) and cDNA obtained with the iScript cDNA synthesis kit (Bio-Rad,Hercules, CA). Target mRNA was quantified using MyIQ single color real time PCR detection system (Bio-Rad) and iQ SYBR green Supermix (Bio-Rad,Hercules,CA). Mouse IL-10 (left, 5’-CAGGGATCTTAGCTAACGGAAA-3’; right, 5’-GCTCAGTGAATAAATAGAATGGGAAC-3’) were used for PCR amplification (cycling parameters 3 min 95°C, 15 secs 95 °C, 30 secs 60°C 40 reps, 1 min 95°C). Single product amplification was confirmed by melting curve analysis and primer efficiency was near 100% in all the experiments performed. Quantification is expressed in arbitrary units and target mRNA levels were normalized to GAPDH expression using the method of Pfaffl (Pfaffl, 2001)

"VSports在线直播" Chromatin Immunoprecipitation (ChIP) assays

ChIP studies were performed as previously described(Villagra et al., 2009). All steps were carried out at 4°C. RAW264.7 or PEM were incubated for 10 min with 1% formaldehyde under gentle agitation. Cross-linking was stopped by the addition of 0.125 M glycine for 5 min. Then, cells were washed with 10 ml of PBS, scraped off in the same volume of PBS, and collected by centrifugation at 1,000g for 5 min. The cell pellet was re-suspended in lysis buffer (50 mM HEPES [pH 7.8], 20 mM KCl, 3 mM MgCl2, 0.1% NP-40, and a cocktail of protease inhibitors) and incubated for 10 min on ice. The cell extract was collected by centrifugation at 1,000g for 5 min, resuspended in sonication buffer (50 mM HEPES [pH 7.9], 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, and a cocktail of protease inhibitors), and incubated for 10 min on ice. To reduce the length of the chromatin fragments to approximately 500 bp (confirmed by electrophoretic analysis and PCR), the extract was sonicated using a BioruptorTM (Diagenode). Eight pulses of 30 seconds with 30 seconds rest time were repeated 6 times at a frequency of 20 KHz. After centrifugation at 16,000g, the supernatant was collected, frozen in liquid nitrogen, and kept at −80°C. An aliquot was used for A260 measurements. Cross-linked extracts (6 U A260) were resuspended in a sonication buffer to a final volume of 500 μl. The samples were pre-cleared by incubation with normal mouse IgG plus protein A/G agarose (Santa Cruz Biotechnology) for 2 h at 4°C with agitation. After centrifugation at 1,000g for 5 min, the supernatant was collected and immunoprecipitated with specific antibodies as detailed for each experiment. The immunocomplexes (except from Flag/agarose conjugates) were recovered with the addition of 30 μl of protein-A agarose beads and subsequent incubation for 2 h at 4°C with agitation. The complexes were washed twice with sonication buffer plus 500 mM NaCl, twice with LiCl buffer (20 mM Tris-HCl [pH 8.0], 250 mM LiCl, 1 mM EDTA, and 0.5% Triton X-100), and twice with TE buffer (2 mM EDTA and 50 mM Tris-HCl [pH 8.0]). The solution was incubated for 5 min at 4°C. The protein-DNA complexes were eluted by incubation with 100 μl of elution buffer (50 mM NaHCO3 and 1% SDS) for 15 min at 65°C. After centrifugation at 1,000g for 5 min, the supernatant was collected and incubated with 10 μg of RNase A per ml for 1 h at 42°C. NaCl was added to the mixture to a final concentration of 200 mM and incubated at 65°C to reverse the cross-linking. The proteins were digested with 200 μg/ml of proteinase K for 2 h at 50°C. The DNA was recovered using Qiagen QiaquickTM columns. Two different set of primers were used for IL-10: IL-10 (proximal region) sense 5’-GGAGGAGGAGCCTGAATAAC-3’ and antisense 5’-CTGTTCTTGGTCCCCCTTTT-3’, and IL-10 (distal region) sense 5’-AACTCAGCCTGGAACTGACC-3’ and antisense 5’- GCCTCTCCTCCTGACACTCTT -3’. All samples and inputs were quantified using MyIQ single color real time PCR detection system (Bio-Rad) and iQ SYBR green Supermix (Bio-Rad). Single product amplification was confirmed by melting curve analysis and primer efficiency was near or close to 100% in all experiments performed. Quantification is expressed in arbitrary units, and target sequence levels were normalized to the input signal using the method of Pfaffl(Pfaffl, 2001). All ChIP experiments were repeated twice starting from the crosslinking, and final quantitative real time PCR was done in triplicates.

The co-chromatin immunoprecipitation (co-ChIP) for HDAC6 and HDAC11 were performed using the same experimental procedure described above adding an extra clearance step between the sequential immunoprecipitations. Briefly, the eluted fraction after the first immunoprecipitation was pre-cleared by incubation with protein A/G agarose (Santa Cruz Biotechnology) for 2 h at 4°C with agitation. After centrifugation at 1,000g for 5 min, the supernatant was collected and immunoprecipitated using specific antibodies as detailed under each experiment.

VSports手机版 - Statistical Analysis

All experiments were repeated at least three times unless indicated otherwise. Unpaired t-tests were performed using Microsoft Excel Software (Microsoft, Redmond, WA) with significance at p < 0.05.

"VSports最新版本" Supplementary Material

01

Supplemental Figure 1: Acetylation status and recruitment of HDAC11 and HDAC6 to the IL10 distal promoter in response to LPS. Macrophages were treated with LPS (1.0 μg/mL), and then harvested at baseline (time 0), or at 0.5, 1, 2, 3, 5 and 7 hours after treatment. Cells were then subjected to ChIP analysis using an anti-acetylated histone 3 (A), anti-HDAC11 (B) or anti-HDAC6 (C) antibodies. Quantitative real time PCR analysis was performed against the IL-10 gene promoter comprising the region between −1322 to −1223. Error bars represent standard deviation from triplicates. Shown is a representative experiment of two independent experiments with similar results.

02

Supplemental Figure 2: Decreased H3 acetylation and HDAC6 recruitment to the IL-10 gene promoter in macrophages treated with Tubastatin A, an isotype selective HDAC6 inhibitor.(A) Peritoneal elicited macrophages (PEMs) were treated with Tubastatin A (5 μM) for

03
04

HDAC6 interacts with HDAC11 in antigen presenting cells

HDAC6 is a positive regulator of IL10 production

Nuclear role of HDAC6 as transcriptional regulator

HDACs as modulators of the APC plasticity to trigger T-cell activation

Figure 6.

Figure 6

Open in a new tab

Representative scheme of the sequential recruitment of HDAC6 and HDAC11 to the IL-10 promoter gene. (A) A Initial recruitment of HDAC6 and HDAC11 to the IL-10 promoter upon stimulation. Transcriptional activity of the promoter is minimal. (B)Maximal transcriptional activity of the IL-10 promoter characterized by a decrease recruitment of HDAC11. Other transcription factors uncharacterized are noted as question marks.

"VSports在线直播" Acknowledgements

This work was supported by PHS Grants CA100850, CA87583, CA134807 (EMS) and CA153246 (AV).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Disclosures

The authors have no financial conflict of interest

References

  1. Aldana-Masangkay GI, Sakamoto KM. The role of HDAC6 in cancer. J Biomed Biotechnol. 2010;2011:875824. doi: 10.1155/2011/875824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Boyault C, Sadoul K, Pabion M, Khochbin S. HDAC6, at the crossroads tbetween cytoskeleton and cell signaling by acetylation and ubiquitination. Oncogene. 2007;26:5468–5476. doi: 10.1038/sj.onc.1210614. ["V体育平台登录" DOI] [PubMed] [Google Scholar]
  3. de Ruijter AJM, van Gennip AH, Caron HN, Kemp S, van Kuilenburg ABP. Histone deacetylases (HDACs): characterization of the classical HDAC family. Biochem. J. 2003;370:737–749. doi: 10.1042/BJ20021321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. de Zoeten EF, Wang L, Butler K, Beier UH, Akimova T, Sai H, Bradner JE, Mazitschek R, Kozikowski AP, Matthias P, Hancock WW. Histone deacetylase 6 and heat shock protein 90 control the functions of Foxp3(+) T-regulatory cells. Mol Cell Biol. 2011;31:2066–78. doi: 10.1128/MCB.05155-11. [V体育ios版 - DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Foster SL, Hargreaves DC, Medzhitov R. Gene-specific control of inflammation by TLR-induced chromatin modifications. Nature. 2007;447:972–978. doi: 10.1038/nature05836. [DOI] [PubMed] [Google Scholar]
  6. Gao L, Cueto MA, Asselbergs F, Atadja P. Cloning and Functional Characterization of HDAC11, a Novel Member of the Human Histone Deacetylase Family. J. Biol. Chem. 2002;277:25748–25755. doi: 10.1074/jbc.M111871200. [DOI] [PubMed] [Google Scholar]
  7. Glozak MA, Seto E. Acetylation/Deacetylation Modulates the Stability of DNA Replication Licensing Factor Cdt1. J Biol Chem. 2009;284:11446–11453. doi: 10.1074/jbc.M809394200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Grütz G. New insights into the molecular mechanism of interleukin-10-mediated immunosuppression. Journal of Leukocyte Biology. 2005;77:3–15. doi: 10.1189/jlb.0904484. [DOI (VSports)] [PubMed] [Google Scholar]
  9. Kozikowski AP, Tapadar S, Luchini DN, Kim KH, Billadeau DD. Use of the Nitrile Oxide Cycloaddition (NOC) Reaction for Molecular Probe Generation: A New Class of Enzyme Selective Histone Deacetylase Inhibitors (HDACIs) Showing Picomolar Activity at HDAC6. Journal of Medicinal Chemistry. 2008;51:4370–4373. doi: 10.1021/jm8002894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Li MO, Flavell RA. Contextual regulation of inflammation: a duet by transforming growth factor-beta and interleukin-10. Immunity. 2008;28:468–76. doi: 10.1016/j.immuni.2008.03.003. [DOI] [PubMed] [Google Scholar]
  11. Medzhitov R, Horng T. Transcriptional control of the inflammatory response. Nat Rev Immunol. 2009;9:692–703. doi: 10.1038/nri2634. ["V体育官网入口" DOI] [PubMed] [Google Scholar]
  12. Murai M, Turovskaya O, Kim G, Madan R, Karp CL, Cheroutre H, Kronenberg M. Interleukin 10 acts on regulatory T cells to maintain expression of the transcription factor Foxp3 and suppressive function in mice with colitis. Nat Immunol. 2009;10:1178–84. doi: 10.1038/ni.1791. ["VSports手机版" DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Pfaffl MW. A new mathematical model for relative quantification in real-time RT PCR. Nucl. Acids Res. 2001;29:e45. doi: 10.1093/nar/29.9.e45. [VSports - DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Rabinovich GA, Gabrilovich D, Sotomayor EM. Immunosuppressive Strategies that are Mediated by Tumor Cells. Annu Rev Immunol. 2007;25:267–96. doi: 10.1146/annurev.immunol.25.022106.141609. ["V体育ios版" DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Rubtsov YP, Rasmussen JP, Chi EY, Fontenot J, Castelli L, Ye X, Treuting P, Siewe L, Roers A, Henderson WR, Jr., Muller W, Rudensky AY. Regulatory T cell-derived interleukin-10 limits inflammation at environmental interfaces. Immunity. 2008;28:546–58. doi: 10.1016/j.immuni.2008.02.017. [DOI] [PubMed] [Google Scholar]
  16. Saraiva M, O'Garra A. The regulation of IL-10 production by immune cells. Nat Rev Immunol. 2010;10:11. doi: 10.1038/nri2711. [V体育2025版 - DOI] [PubMed] [Google Scholar]
  17. Serrador JM, Cabrero JR, Sancho D, Mittelbrunn M, Urzainqui A, Sanchez-Madrid F. HDAC6 deacetylase activity links the tubulin cytoskeleton with immune synapse organization. Immunity. 2004;20:417–28. doi: 10.1016/s1074-7613(04)00078-0. [DOI] [PubMed] [Google Scholar]
  18. Sotomayor EM, Fu YX, Lopez-Cepero M, Herbert L, Jimenez JJ, Albarracin C, Lopez DM. Role of tumor-derived cytokines on the immune system of mice bearing a mammary adenocarcinoma. II. Down-regulation of macrophage-mediated cytotoxicity by tumor-derived granulocyte-macrophage colony-stimulating factor. J Immunol. 1991;147:2816–23. [PubMed] [Google Scholar]
  19. Todd PK, Oh SY, Krans A, Pandey UB, Di Prospero NA, Min K-T, Taylor JP, Paulson HL. Histone Deacetylases Suppress CGG Repeatâ “Induced Neurodegeneration Via Transcriptional Silencing in Models of Fragile X Tremor Ataxia Syndrome. PLoS Genet. 2010;6:e1001240. doi: 10.1371/journal.pgen.1001240. [V体育官网 - DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Toropainen S, Väisänen S, Heikkinen S, Carlberg C. The Down-regulation of the Human MYC Gene by the Nuclear Hormone 1[alpha],25-dihydroxyvitamin D3 is Associated with Cycling of Corepressors and Histone Deacetylases. J Mol Biol. 2010;400:284–294. doi: 10.1016/j.jmb.2010.05.031. [DOI] [PubMed] [Google Scholar]
  21. Valenzuela-Fernández A, Cabrero JR, Serrador JM, Sánchez-Madrid F. HDAC6: a key regulator of cytoskeleton, cell migration and cell-cell interactions. Trends in Cell Biology. 2008;18:291–297. doi: 10.1016/j.tcb.2008.04.003. [DOI] [PubMed] [Google Scholar]
  22. Vicente-Suarez I, Takahashi Y, Cheng F, Horna P, Wang HW, Wang HG, Sotomayor EM. Identification of a novel negative role of flagellin in regulating IL-10 production. Eur J Immunol. 2007;37:3164–75. doi: 10.1002/eji.200737306. [DOI] [PubMed] [Google Scholar]
  23. Villagra A, Cheng F, Wang HW, Suarez I, Glozak M, Maurin M, Nguyen D, Wright KL, Atadja PW, Bhalla K, Pinilla-Ibarz J, Seto E, Sotomayor EM. The histone deacetylase HDAC11 regulates the expression of interleukin 10 and immune tolerance. Nat Immunol. 2009;10:92–100. doi: 10.1038/ni.1673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Villagra A, Cruzat F, Carvallo L, Paredes R, Olate J, van Wijnen AJ, Stein GS, Lian JB, Stein JL, Imbalzano AN, Montecino M. Chromatin Remodeling and Transcriptional Activity of the Bone-specific Osteocalcin Gene Require CCAAT/Enhancer-binding Protein beta-dependent Recruitment of SWI/SNF Activity. J. Biol. Chem. 2006;281:22695–22706. doi: 10.1074/jbc.M511640200. ["VSports在线直播" DOI] [PubMed] [Google Scholar]
  25. Wakkach A, Fournier N, Brun V, Breittmayer JP, Cottrez F, Groux H. Characterization of dendritic cells that induce tolerance and T regulatory 1 cell differentiation in vivo. Immunity. 2003;18:605–17. doi: 10.1016/s1074-7613(03)00113-4. ["V体育平台登录" DOI] [PubMed] [Google Scholar]
  26. Woan KV, Sahakian E, Sotomayor EM, Seto E, Villagra A. Modulation of antigen-presenting cells by HDAC inhibitors: implications in autoimmunity and cancer. Immunol Cell Biol. 2012;90:55–65. doi: 10.1038/icb.2011.96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Yang XJ, Seto E. The Rpd3/Hda1 family of lysine deacetylases: from bacteria and yeast to mice and men. Nat Rev Mol Cell Biol. 2008;9:206–18. doi: 10.1038/nrm2346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Zhang X, Edwards JP, Mosser DM. Dynamic and Transient Remodeling of the Macrophage IL-10 Promoter during Transcription. J Immunol. 2006;177:1282–1288. doi: 10.4049/jimmunol.177.2.1282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Zhang X, Yuan Z, Zhang Y, Yong S, Salas-Burgos A, Koomen J, Olashaw N, Parsons JT, Yang X-J, Dent SR, Yao T-P, Lane WS, Seto E. HDAC6 Modulates Cell Motility by Altering the Acetylation Level of Cortactin. Molecular Cell. 2007;27:197–213. doi: 10.1016/j.molcel.2007.05.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zhang Y, Kwon S, Yamaguchi T, Cubizolles F, Rousseaux S, Kneissel M, Cao C, Li N, Cheng HL, Chua K, Lombard D, Mizeracki A, Matthias G, Alt FW, Khochbin S, Matthias P. Mice lacking histone deacetylase 6 have hyperacetylated tubulin but are viable and develop normally. Mol Cell Biol. 2008;28:1688–701. doi: 10.1128/MCB.01154-06. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

01

Supplemental Figure 1: Acetylation status and recruitment of HDAC11 and HDAC6 to the IL10 distal promoter in response to LPS. Macrophages were treated with LPS (1.0 μg/mL), and then harvested at baseline (time 0), or at 0.5, 1, 2, 3, 5 and 7 hours after treatment. Cells were then subjected to ChIP analysis using an anti-acetylated histone 3 (A), anti-HDAC11 (B) or anti-HDAC6 (C) antibodies. Quantitative real time PCR analysis was performed against the IL-10 gene promoter comprising the region between −1322 to −1223. Error bars represent standard deviation from triplicates. Shown is a representative experiment of two independent experiments with similar results.

NIHMS580014-supplement-01.pdf (368.1KB, pdf)
02

Supplemental Figure 2: Decreased H3 acetylation and HDAC6 recruitment to the IL-10 gene promoter in macrophages treated with Tubastatin A, an isotype selective HDAC6 inhibitor.(A) Peritoneal elicited macrophages (PEMs) were treated with Tubastatin A (5 μM) for

NIHMS580014-supplement-02.pdf (327.3KB, pdf)
03
NIHMS580014-supplement-03.pdf (281.9KB, pdf)
04
NIHMS580014-supplement-04.pdf (300.6KB, pdf)

RESOURCES