Skip to main page content (V体育安卓版)
U.S. flag

An official website of the United States government

Dot gov

The . gov means it’s official. Federal government websites often end in VSports app下载. gov or . mil. Before sharing sensitive information, make sure you’re on a federal government site. .

Https

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely. V体育官网.

. 2011 Mar;53(3):996-1006.
doi: 10.1002/hep.24107. Epub 2011 Feb 11.

Overexpression of cholesterol 7α-hydroxylase promotes hepatic bile acid synthesis and secretion and maintains cholesterol homeostasis (V体育安卓版)

Tiangang Li  1 , Michelle Matozel, Shannon Boehme, Bo Kong, Lisa-Mari Nilsson, Grace Guo, Ewa Ellis, John Y L Chiang
Affiliations

Overexpression of cholesterol 7α-hydroxylase promotes hepatic bile acid synthesis and secretion and maintains cholesterol homeostasis

Tiangang Li (V体育官网) et al. Hepatology. 2011 Mar.

Abstract

We reported previously that mice overexpressing cytochrome P450 7a1 (Cyp7a1; Cyp7a1-tg mice) are protected against high fat diet-induced hypercholesterolemia, obesity, and insulin resistance. Here, we investigated the underlying mechanism of bile acid signaling in maintaining cholesterol homeostasis in Cyp7a1-tg mice VSports手机版. Cyp7a1-tg mice had two-fold higher Cyp7a1 activity and bile acid pool than did wild-type mice. Gallbladder bile acid composition changed from predominantly cholic acid (57%) in wild-type to chenodeoxycholic acid (54%) in Cyp7a1-tg mice. Cyp7a1-tg mice had higher biliary and fecal cholesterol and bile acid secretion rates than did wild-type mice. Surprisingly, hepatic de novo cholesterol synthesis was markedly induced in Cyp7a1-tg mice but intestine fractional cholesterol absorption in Cyp7a1-tg mice remained the same as wild-type mice despite the presence of increased intestine bile acids. Interestingly, hepatic but not intestinal expression of several cholesterol (adenosine triphosphate-binding cassette G5/G8 [ABCG5/G8], scavenger receptor class B, member 1) and bile acid (ABCB11) transporters were significantly induced in Cyp7a1-tg mice. Treatment of mouse or human hepatocytes with a farnesoid X receptor (FXR) agonist GW4064 or bile acids induced hepatic Abcg5/g8 expression. A functional FXR binding site was identified in the Abcg5 gene promoter. Study of tissue-specific Fxr knockout mice demonstrated that loss of the Fxr gene in the liver attenuated bile acid induction of hepatic Abcg5/g8 and gallbladder cholesterol content, suggesting a role of FXR in the regulation of cholesterol transport. .

Conclusion: This study revealed a new mechanism by which increased Cyp7a1 activity expands the hydrophobic bile acid pool, stimulating hepatic cholesterol synthesis and biliary cholesterol secretion without increasing intestinal cholesterol absorption. This study demonstrated that Cyp7a1 plays a critical role in maintaining cholesterol homeostasis and underscores the importance of bile acid signaling in regulating overall cholesterol homeostasis. V体育安卓版.

PubMed Disclaimer

Conflict of interest statement

Potential conflict of interest: nothing to report

Figures

Fig 1
Fig 1
Cyp7a1-tg mice had increased bile acid pool and altered bile acid composition. Total bile acid pool size was determined by adding bile acid contents in liver, gallbladder and intestine (A). Fecal bile acid contents are shown in (B). Results are expressed as mean ± S.E. n=4. An “*” indicates significant difference, P< 0.05, Cyp7a1-tg vs. wild type controls. (C). Gallbladder bile acid composition was determined in individual wild type or Cyp7a1-tg mouse. Individual bile acids were determined by GC/MS method and expressed as the percentage of total bile acid pool. All data are statistically significant different, Cyp7a1-tg vs. wild type, % mean ±standard error of the mean (sem), p<0.05, n=4. All bile acids determined are tauro-conjugated: DCA, deoxycholic acid; UDCA, ursodeoxycholic acid; CDCA, chenodeoxycholic acid; α-MCA, α-muricholic acid; β-MCA, β-muricholic acid; CA, cholic acid, HCA, hyocholic acid.
Fig 2
Fig 2
Cyp7a1-tg mice had higher gallbladder and fecal cholesterol contents. Gallbladder, fecal, liver and plasma cholesterol content was determined with an assay kit as described under Materials and Methods. Results are expressed as mean ± S.E. n=4–6. An “*” indicates significant difference, P< 0.05, Cyp7a1-tg vs. wild type controls.
Fig 3
Fig 3
Cyp7a1-tg mice had higher biliary cholesterol and bile acid secretion and increased hepatic cholesterol synthesis, but unaltered intestine cholesterol absorption. Bile was collected from 6 hr fasted mice for one hr via common bile duct cannulation. Biliary cholesterol secretion (A), biliary bile acid secretion (B), biliary phospholipid secretion (C), hepatic de novo cholesterol synthesis (D), and intestine cholesterol absorption (E) were determined as described under Materials and Methods. Results are expressed as mean ± S.E. n=3–4. An “*” indicates significant difference, P< 0.05, Cyp7a1-tg vs. wild type controls.
Fig 4
Fig 4
Cyp7a1-tg mice had higher expression of hepatic ABCG5 and ABCG8. (A) Wild type and Cyp7a1-tg mice on chow diet were fasted overnight and ABCG5 and ABCG8 protein levels in the liver and the intestine were determined by Western blot. The protein expression in individual Cyp7a1-tg mouse and its respective littermate control was compared. (B) Hepatocytes were isolated from wild type mouse livers and treated with 25 μM of CDCA or CA, or 2 μM GW4064 for 24 hr, and mRNA expression was determined by real-time PCR. Results are expressed as mean ± S.E. An “*” indicates significant difference, p< 0.05, Cyp7a1-tg vs. non-treated controls. (C) & (D). Primary human hepatocytes (n=3) were treated with 25 μM CDCA or CA, 10 μM DCA or LCA, 2 μM GW4064, 1 μM TO901317 or 20 μg/ml cholesterol for 24 hr. mRNA expression (C) or protein levels (D) was determined by real-time PCR or Western blot, respectively. Results are expressed as mean ± S.E. An “*” indicates significant difference, P< 0.05, Cyp7a1-tg vs. non-treated controls.
Fig 5
Fig 5
Mouse Abcg5 promoter and Abcg8 intron 1 has a FXR response element (FXRE) that is functional in the liver, but not intestine. (A) Upper panel: various mouse abcg5 promoter/reporter plasmids were co-transfected with FXR and RXRα expression plasmids into HepG2 cells. Cells were then treated with vehicle (DMSO) or GW4064 (2 μM) for 24 h and luciderase activity was determined and normalized to β-gal activity. Assays were performed in triplicates and expressed as mean ± S.D. An *” indicates significant difference, p< 0.05, Cyp7a1-tg vs. vehicle treated controls. Lower panel: An illustration of the mouse Abcg5 and Abcg8 gene structure, construction of Abcg5 promoter reporter plasmids and localization a putative FXRE sequence in Abcg5 promoter or Abcg8 intron 1. (B) EMSA assay of FXR/RXR binding to 32P labeled mouse FXRE probes from Abcg5/g8, Shp and Fas genes. Mut, mutant ABCG5 FXRE. N.S. none-specific bands. Probes used are: G5/8-FXRE: GGGACAGTCACATGGGTCAACGCTCTGT GATG, mutant G5/8-FXRE: GGGACAGTCACATGGCTCGAGGCTCTGTGATG, FAS-FXRE: GGCGGCGGGGGTCAACGCCCGCACTT, SHP-FXRE: GGCAGCCTGGGTTAATGACCCTG TTTA. (C) & (D). In vivo quantitative ChIP assay of FXR occupancy on Abcg5/g8 gene. Nuclei were isolated from individual mouse liver (left panel) and intestine (right panel) for ChIP assay with an FXR antibody as described in Supplemental Materials and Methods. FXR binding to SHP promoter was used as a positive control.
Fig 6
Fig 6
Hepatic and gallbladder lipid content in tissue-specific Fxr knockout mice. Wild type, Liver-specific Fxr knockout mice (L-FXR-KO) and intestine-specific Fxr knockout mice (I-FXR-KO) were fed either a chow diet or a chow diet supplemented with 0.5% cholic acid (CA) for 1 week. (A) Hepatic cholesterol content. (B) Gallbladder cholesterol content and (C) Gallbladder phospholipid content were determined. Results are expressed as mean ± S.E. n=3–5, an “*” indicates significant difference, p< 0.05, cholic acid fed vs. chow fed controls. A “**” indicates significant difference between two different groups of mice, p< 0.05. NS: not significant.
Fig 7
Fig 7
Loss of liver Fxr abolished cholic acid induction of ABCG5 and ABCG8 in mouse livers. Wild type, Liver-specific Fxr knockout mice (L-FXR-KO) and intestine-specific Fxr knockout mice (I-FXR-KO) were fed either a chow diet or a chow diet supplemented with 0.5% cholic acid (CA) for 1 week. Hepatic and intestine mRNA expressions were determined by real-time PCR.Results are expressed as mean ± S.E. n=3–5, “*”, statistical significance, p < 0.05, cholic acid fed vs. chow fed controls. A “**” indicates significant difference between two groups of mice, p< 0.05.
See this image and copyright information in PMC

References

    1. Li T, Owsley E, Matozel M, Hsu P, Novak CM, Chiang JY. Transgenic expression of cholesterol 7α-hydroxylase in the liver prevents high-fat diet-induced obesity and insulin resistance in mice. Hepatology. 2010;52:678–690. - PMC - PubMed
    1. Chiang JY. Bile acids: regulation of synthesis. J Lipid Res. 2009;50:1955–1966. - PMC (V体育2025版) - PubMed
    1. Pullinger CR, Eng C, Salen G, Shefer S, Batta AK, Erickson SK, Verhagen A, et al. Human cholesterol 7α-hydroxylase (CYP7A1) deficiency has a hypercholesterolemic phenotype. J Clin Invest. 2002;110:109–117. - PMC (VSports注册入口) - PubMed
    1. Hylemon PB, Zhou H, Pandak WM, Ren S, Gil G, Dent P. Bile acids as regulatory molecules. J Lipid Res. 2009;50:1509–1520. - PMC - PubMed
    1. Miyake JH, Duong-Polk XT, Taylor JM, Du EZ, Castellani LW, Lusis AJ, Davis RA. Transgenic Expression of Cholesterol 7α-Hydroxylase Prevents Atherosclerosis in C57BL/6J Mice. Arterioscler Thromb Vasc Biol. 2002;22:121–126. - PubMed

Publication types (V体育官网入口)

"VSports最新版本" MeSH terms

Substances

LinkOut - more resources