<code lang="8Gxu0N5a"></code> Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Jul 14.
Published in final edited form as: Stem Cell Res. 2012 Dec 9;10(2):203–212. doi: 10.1016/j.scr.2012.12.001

"VSports最新版本" The CSF-1 receptor fashions the intestinal stem cell niche✩

Dilara Akcora a, Duy Huynh a, Sally Lightowler (VSports在线直播) a, Markus Germann a, Sylvie Robine b, Jan R de May c,d, "V体育ios版" Jeffrey W Pollard e, E Richard Stanley e, V体育安卓版 - Jordane Malaterre a, Robert G Ramsay a,*
PMCID: PMC4096353  NIHMSID: NIHMS580161  PMID: 23314290

Abstract

Gastrointestinal (GI) homeostasis requires the action of multiple pathways. There is some controversy regarding whether small intestine (SI) Paneth cells (PCs) play a central role in orchestrating crypt architecture and their relationship with Lgr5+ve stem cells. Nevertheless, we previously showed that germline CSF-1 receptor (Csf1r) knock out (KO) or Csf1 mutation is associated with an absence of mature PC, reduced crypt proliferation and lowered stem cell gene, Lgr5 expression VSports最新版本. Here we show the additional loss of CD24, Bmi1 and Olfm4 expression in the KO crypts and a high resolution 3D localization of CSF-1R mainly to PC. The induction of GI-specific Csf1r deletion in young adult mice also led to PC loss over a period of weeks, in accord with the anticipated long life span of PC, changed distribution of proliferating cells and this was with a commensurate loss of Lgr5 and other stem cell marker gene expression. By culturing SI organoids, we further show that the Csf1r−/− defect in PC production is intrinsic to epithelial cells as well as definitively affecting stem cell activity. These results show that CSF-1R directly supports PC maturation and that in turn PCs fashion the intestinal stem cell niche.

Introduction

The maintenance of gastrointestinal homeostasis and the response to tissue damage require the orchestration of intestinal stem and progenitor cell populations. Several signaling pathways regulate the maintenance and differentiation of intestinal stem cells (ISCs) which are also dependent on other cell types, including ISC-derived Paneth cells (PCs) (Barker et al. , 2007) V体育平台登录. PC development within the crypt is dependent on the colony stimulating factor-1 (CSF-1) (Huynh et al. , 2009), the primary regulator of the development of macrophages and osteoclasts. CSF-1 effects are mediated by the CSF-1 receptor (CSF-1R), which is expressed on PC, macrophages and osteoclasts (Chitu and Stanley, 2006).

In mice deficient in either CSF-1 (Csf1op/op) or CSF-1R (Csf1r−/−) the PCs fail to develop and the SI exhibited cell proliferation and differentiation defects associated with reduced expression of the ISC marker Lgr5. This phenotype can be rescued in Csf1op/op mice by a membrane-spanning cell-surface isoform of CSF-1 that acts locally and does not contribute to the pool of circulating CSF-1, suggesting juxtacrine or paracrine regulation of PC by CSF-1 (Huynh et al. , 2009) VSports注册入口. Consistent with such local regulation, the Csf1 promoter is active in cells in the crypt that closely neighbor PC (Huynh et al. , 2009). In single Lgr5+ ISC-derived cultures, there is a close physical association of ISC with PC which express multiple ligands important to ISC maintenance and co-culture of ISC with PC markedly improves organoid formation (Sato et al. , 2011). Together, these studies indicated that locally expressed CSF-1 is required for PC development and that PCs directly support the maintenance of ISC.

Despite the circumstantial evidence at least two important questions remain unresolved concerning the role of CSF-1 and PC in the regulation of ISC. The first is whether there is a direct or indirect role of macrophages in the lamina propia and/or those below the crypt base that, with PC, are also dramatically reduced in Csf1op/op and Csf1r−/− mice. The second is whether the CSF-1R is required for both PC development and/or PC maintenance in adult mice. To address these questions, we used intestinal epithelial specific inducible deletion of Csf1r and in vitro organoid cultures V体育官网入口. We find that the defects evident in mice with germline deletion of Csf1r were recapitulated by the conditional KO studies but the phenotype took several weeks to manifest consistent with the long half life of PC. The use of organoid cultures with either germline or inducible deletion of Csf1r led to reduced colonies and size as well as defective ISC gene expression indicating that CSF-1R is essential and cell intrinsic to the ISC niche.

Material and methods

"VSports app下载" Mice

Csf1r−/Csf1r− (Csf1r−/−) mice on a FVB/NJ background were generated by heterozygote intercrossing and sacrificed at two weeks of age (Dai et al. , 2002). VillinCreERT2 (el Marjou et al. , 2004) and Csf1rflox/Csf1rflox (Csf1rfl/fl) (Li et al. , 2006) on a C57Bl/6 background were housed under SPF conditions. Experiments were conducted with animal experimentation ethics committee approval. Tamoxifen (Sigma-Aldrich, Australia) was administered (100 mg/kg) in the chow VSports在线直播.

Immunohistochemistry

Mouse pups (P14) were perfused with periodate-lysine-2% paraformaldehyde-0 V体育2025版. 05% glutaraldehyde, pH 7. 4, and processed as described (Huynh et al. , 2009). Anti-PCNA and anti-CD24 antibodies were used followed by processing with the Dako Envison+mouse detection kit (Campbellfield, Vic, Australia). For H&E staining, intestine sections were fixed in methacarn for 2 h and transferred to 70% ethanol, embedded and sectioned. Full crypts exposing a lumen and identifiable base were scored. Crypt position counting was performed as described (Malaterre et al. , 2007). HRP reactions were developed with Pierce Metal-enhanced detection reagent. Antibodies and titres used are listed in Table 1.

Table 1.

Antibodies.

Antigen Species (titre) Source
CSF-1R Rabbit anti-mouse (1:250) Upstate Biotech, USA (06174)
PCNA Mouse PC-10 (1:100) BD Transduction (610665)
Lysozyme Rabbit anti-mouse (1:100) Thermo Scientific (RB 372 A1)
CD24 Rat (1:100) Santa Cruz (sc-52468)
β-Catenin Mouse (1:100) BD Transduction Labs (610154)
IF Alexa Fluor 488 (green) secondary antibody Mouse (1:500) Molecular Probes (A11001)
IF Alexa Fluor 488 (green) secondary antibody Rabbit (1:500) Molecular Probes (A11034)
Anti-mouse-HRP Goat (1:250) (Bio-Rad)
DAPI (1:1000) Molecular Probes (D1306)
Open in a new tab

Immunofluorescence

Crypts were fixed for 10 min in 4% paraformaldehyde and subsequently 0. 4% overnight, prior to blocking with 1% fetal bovine serum or rabbit serum for 1 h. Primary antibodies to the CSF-1R, β-catenin and lysozyme were applied overnight at ambient temperature and processed as described (Ramsay et al. , 2004). Nuclei were identified by DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride). Crypts were imaged using an Olympus Fluoroview FV1000 Confocal microscope VSports. Imaris software (Bitplane Inc. St Paul, MN, USA) was used to generate 3D images for movies of whole crypts.

V体育官网入口 - Organoid cultures

The SI was excised from 2 to 3 weeks oldWT and Csf1r−/− or 4–5 weeks old, WT, VillinCreERT2 and Csf1rfI”f’;VminCreERT2 mice. Briefly, mice were euthanized, the entire SI was removed. Crypts were isolated and dissociated as described (Sato et al., 2009). One thousand crypts were seeded in 50 µl Phenol Red-free Matrigel (BD Bioscience North Ryde, Australia) overlayed with 500 µL of DME medium/F12 (Sigma, St. Louis, MO) containing 20 ng/ml EGF (BD Biosciences), 10 ng/ml basic FGF (Roche, Kew, Vic, Australia), 500 ng/ml R-Spondin (R&D Systems, Minneapolis, MN), 100 ng/ml Noggin (Peprotech, Rocky Hill, NJ), and B27supplement (Invitrogen, Mulgrave, Vic, Australia) in 24-well plates. Crypt nests derived from Csf1rfl/fl;VillinCreERT2 and wt; VillinCreERT2 mice were treated with 4-hydroxy-tamoxifen (4OHT, Sigma-Aldrich, 0.1 µM) with medium changes every 2–3 days and after 7 days the organoids were counted. MTT (4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assays were performed after 7 days of culture.

Gene expression and qRT-PCR primers

SI crypt epithelium was prepared, and its purity was confirmed by phase contrast microscopy of crypts. Villi were mostly excluded from these preparations. Real-time reverse transcription-polymerase chain reactions (RT-PCRs) were conducted on genomic DNA-depleted RNA using a StepOnePlus real time PCR system machine (Applied Bisosystems, CA. USA) and the appropriate primers. Gene expression was normalized to Gapdh expression. Amplification parameters were: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min and a final cycle for themelt curve at 95 °C for 15 min, 60 °C for 1 min and 95 °C for 15 s. Primer sequences are tabulated in Table 2.

Table 2.

Oligonucleotide sequences.

Gene GenBank
accession #		 Forward primer Base number
of forward
primer		 Reverse primer Base number
of reverse
primer
Csflrflox N/A 5′ CAAGCTGGTGCGGATTCG 5′ TCTTGGAAGTCACTGTTTAGGG
Csflr NM_001037859 5′ CCTCCTCTGGTCCTGCTG 991–1008 5′ CATTCCACACTGCCATTGC 4725–4744
c-Myc NM_001177352.1 5′ AAGGCCCCCAAGGTAGTGA 4963–4981 5′ TGCTCGTCTGCTTGAATGGA 5011–5030
CyclinDI NM_007631 5′ AGGCTACAGAAGAGTATTTATGGGAAA 9129–9155 5′ TGCGTTTGAATCAAGGGAGAT 9191–9211
L§r5 NM_010195 5′ CAAGCCATGACCTTGGCCCTG 109915–109935 5′ TTTCCCAGGGAGTGGATTCTATT 113149–113171
Olfm4 NM_001030294.1 5′ GCCACTTTCCAATTTCAC 6472–6489 5′ GAGCCTCTTCTCATACAC 12104–12121
Bmi1 NM_007552 5′ AATTAGTCCCAGGGCIIIICAA 6454–6475 5′ TCTTCTCCTCATCTGCAACTTCTC 6785–6808
c-Myb NM_001198914.1 5′ AATTATCTGCCCAACCGG 6891–8606 5′ AGACCAACGCTTCGGACC 8953–8970
CD24a NM_009846 5′ GGCAACCACAAGTCCAATG 4252–4270 5′ AACTCCAGCAGATTCAATAGC 4393–4413
Hes1 NM_008235 5′ CTCGCTCACTTCGGACTC 3603–3620 5′ GTGGGCTAGGGACTTTACG 3667–3685
MatM NM_007500.4 5′ ATGCACGGGCTGAACCA 1282–1298 5′ TCGTTGTTGAAGGACGGGATA 1323–1343
Gapdh NM_008084 5′ GTATGACTCCACTCACGG 3746–3763 5′ GGTCTGGCTCCTGGAAGA 3829–3846
Open in a new tab

"V体育安卓版" Results

CD24 is lost in Csflr null SI (VSports注册入口)

We have previously shown that Csf1r−/− crypts are deficient in PC by staining for antigens which are indicative of the products they generate, including lysozyme and cryptdins (Huynh et al., 2009). With the discovery that PC may have a direct role in support in intestinal stem cells (ISC) we also evaluated the effect on the ISC gene, Lgr5 finding it was similarly lost along with PCs (Huynh et al., 2009). To advance this further here we investigated the expression of an additional cell surface marker employed to enrich PC and ISC, CD24 (Gracz et al., 2010; Sato et al., 2011; von Furstenberg et al., 2011) in Csf1r−/− crypts by IHC and found to be mostly lost compared to WT crypts (Figs. 1A–B). This implied that both categories of cells that collectively constitute the intestinal stem cell niche were lost.

Figure 1.

Figure 1

Open in a new tab

Global CSF-1R loss affects on mature Paneth cells and intestinal stem cells (ISCs). (A) The Paneth cell (PC) and ISC marker, CD24, are expressed at the base of the SI crypt (brown arrow). (B) Reduced CD24 expression and loss of PC and ISC in Csf1r−/− mouse SI crypts. (C) When crypts are liberated from the SI villi are usually sheared away (broken lines) allowing the production of enriched crypts separated from the ISC niche. A cartoon depicting this is shown. (D) Confocal IF images reconstructed into a 3D format show coincident expression of CSF-1R (green) and lysozyme (red) at the crypt base. DAPI (blue) defines the crypt nuclei (see Movies in Supplementary data). (E) 2D confocal image of Csf1r−/− crypts shows no CSF-1R (green) and minimal lysozyme (red). Similarly prepared 2D confocal images of crypts show (F) DAPI-stained nuclei (blue) most (G) CSF-1R (green) associated with PC (green arrow). (H) Co-staining with β-catenin (red) as a merged image of (F) and (G) highlights the epithelial cells (red). Scale bar=50 µm. Magnification ×60.

Notch and Wnt target gene expression is affected in VSports手机版 - Csflr null SI crypts

As others have reported Paneth cell production is distorted by the deletion of Notch pathway gene Atoh1/Math1 (Durand et al., 2012; Kim et al., 2012). Accordingly, when Math1 expression was examined in SI crypts from Csf1r−/− mice we observed a trend towards increased expression (Supplementary Fig. 1) entirely consistent with an increase in PAS and Alcian Blue histochemistry (Huynh et al., 2009) as well as a commensurate loss of Math-1 negative regulator Hes-1 (Akazawa et al., 1995; Ishibashi et al., 1995) mRNA levels (Supplementary Fig. 1). This suggests that Notch signaling is affected when PCs are lost. Similarly, we reported previously that Wnt target genes Lgr5 and CyclinD1 expression were also significantly reduced in Csf1r−/− SI crypts consistent with the observed reduced proliferation (Huynh et al., 2009) and an effect on Wnt signaling. These data suggest that the PC deficit reported here and that shown in Sox9 KO mice (Bastide et al., 2007; Gracz et al., 2010; Mori-Akiyama et al., 2007) differs from that reported in Atoh1/Math1 KO mice; a view also held by others (Rizk and Barker, 2012).

CSF-1 receptor is expressed most strongly by Paneth cells in isolated crypts

To more precisely localize where CSF-1R was expressed in crypts we first isolated crypts using an established EDTA method which in the SI leads to villi loss through shearing (Fig. 1C) and visualized CSF-1R and lysozyme by 3D confocal microscopy in the crypts alone (Fig. 1D) (corresponding movies are also provided as Supplementary data online). When CSF-1R is deleted a substantial reduction in lysozyme staining is evident (Fig. 1E). Further confocal images of β-catenin basal–lateral staining and CSF-1R are shown (Figs. 1F–H). Collectively these data highlight the basal– lateral expression of Csf-1R on PC in SI crypts where the pericryptal fibroblasts have been definitively left behind with the mucosa during the processing of the samples and that CD24 is essentially completely lost in the KO SI.

Csf1r null crypts show impeded capacity to form organoids

It is considered that ISC genes and PC play an important role in the generation of crypts and with the advent of SI organoid cultures now it is feasible to directly test the role of other pathways such as the CSF-1R signaling. When organoid cultures were initiated from Csf1r−/− mice it was very clear that they were substantially impeded in this capacity visually (Fig. 2A) and in terms of organoid number and size (Fig. 2B). Notably, those Csf1r−/− organoids that did form were invariably associated with the early appearance of granulated cells (PCs). These data show that the decrease in ISC marker expression and progenitor proliferation previously observed in Csf1r−/− SI in vivo (Huynh et al., 2009) can be replicated in vitro, demonstrating an epithelial cell-intrinsic defect.

Figure 2.

Figure 2

Open in a new tab

Global CSF-1R loss affects on intestinal stem cell (ISC) function and gene expression signatures in vitro. (A) Organoid cultures generated by WT and Csf1r−/− ISC shown at days 1, 3 and 5 indicate delayed growth of the KO organoids (Bar=20 µM). (B) Quantitation of WT and Csf1r−/− organoid numbers after 7 days in culture (equivalent numbers of crypt nests were plated at day 0) (*p=0.05; ***=0.001; student t-test). Organoid cultures initiated from WT and Csf1r−/− mice were harvested at day 7, RNA prepared and subjected to qRT-PCR using primers for ISC genes (C) Bmi1, (D) Olfm4 and (E) Lgr5 (*p<0.05; Mann Whitney test).

Expression of intestinal stem cell genes is lost in Csf1r null crypts (VSports手机版)

Indicative of the absence of CD24 in the PC and ISC it would be predicted that there should also be a commensurate loss of ISC stem cell gene expression in organoid cultures established from Csf1r−/− mice. This is indeed the case whereby Bmi-1, Olfm4 and Lgr5 are expressed at significantly reduced levels (Figs. 2C–E).

Intestinal-specific deletion of Csf1r demonstrates intrinsic defect in PC maturation

To directly address the question of whether any of these effects were mediated by non-PC cell types, Csf1rf//fl mice (Li et al., 2006) were crossed to mice expressing a tamoxifeninducible Cre-transgene driven by an intestine-specific promoter (VillinCreERT2) (el Marjou et al., 2004). Epithelial cell Csf1r gene deletion was apparent, as assessed by loss of CSF-1R staining in the SI crypts, but not in adjacent lamina or muscularis propria (Figs. 3A–B). PC, assessed by lysozyme staining visualized by 3D imaging shows some lysozyme staining persisted at the base of the crypts (Fig. 3C) but most of this was remnant lysozyme within the crypt lumen or that associated with, and expected of, macrophages. Overall the amount of lysozyme was substantially decreased after 4 weeks of tamoxifen administration (Fig. 3D). This relatively slow PC ablation suggests that CSF-1R signaling is not essential for short-term survival of PC, but rather that it is required for their replacement and is consistent with estimates of the PC lifespan of greater than 30 days (Ireland et al., 2005). Commensurate with the loss of the PC was a concomitantly reduced expression of Lgr5 (Fig. 3E). Interestingly, an increased abundance of proliferating cell nuclear antigen (PCNA)+ve cells at the crypt base suggested that these cells were occupying the address of the disappearing PC (Fig. 3F). This phenomenon of crypt cells occupying the vacated positions of the lost PCs has been noted in the case of the Sox9 KO mouse (Sato et al., 2011).

Figure 3.

Figure 3

Open in a new tab

Conditional CSF-1R inactivation effects on Paneth cells and crypt proliferation. (A) CSF-1R (green) at the crypt base (green arrows) in association with lysozyme (red) as well as in the lamina propria and muscularis is shown. (B) PC loss in mice following the tamoxifen-induced inactivation (2 weeks) of the Csf1r gene and loss of Csf-1R expression (green arrow). (C) 3D image of a SI crypt from a Csf1rf//fl;VillinCreERT2 mouse after 2 weeks of tamoxifen exposure. (D) Lysozyme expression (brown arrow) determined by IHC in the ileum of Csf1rf//fl;VillinCreERT2 mice after 4 weeks of tamoxifen exposure indicates substantive loss of mature PC. (E) ISC Lgr5 expression is reduced in inducible, intestinal-specific Csf1r deleted mice. (F) Displacement of PC, or replacement by, PCNA+ve cells in the base of the SI crypts of Csf1rf//fl;VillinCreERT2 mice after 4 weeks of tamoxifen exposure leads to significantly more PCNA+ve cells at the crypt base. (*p=0.05, ***=0.001; Student t-test).

Sustained reduction of ISC gene expression in conditional Csf1r deleted mice

In view of the extended life span displayed by PC we conducted a further study whereby Csf1rfIlfl;VillinCreERT2 mice were provided tamoxifen in their chow ad libitum for 4 weeks and then followed in the absence of steroid for a further 4 weeks. When the SI was examined their appearance was similar to that observed at 4 weeks (with partial to complete absence of PC: as measured by lysozyme) but some crypts had PCs and in these the PCNA positive cells were now normally redistributed (data not shown). These data suggested that in ISC where Csf1r was not ablated restoration of the crypt cell composition had occurred. Such escaper crypts are commonly observed in these types of models (Sato et al., 2011). Nevertheless, to examine the gene expression status within the SI crypts of these mice subjected to 4 weeks with tamoxifen and 4 week chase we performed qRT-PCR to show that Csf1r remained significantly reduced as was the expression of Lgr5 and Olfm4 compared to Csf1rfl/fl;VillinCreERT2 mice not exposed to tamoxifen (Fig. 4). Other cell cycle genes (c-Myb, CyclinD1 and c-Myc) were slightly but not significantly reduced in these samples. Collectively these observations indicate that by 8 weeks the crypts were progressively recovering but nevertheless the deletion of CSF-1R has a sustained impact on ISC gene expression.

Figure 4.

Figure 4

Open in a new tab

Reduced ISC gene expression is durable for several weeks following loss of Paneth cells. Significant gene expression changes for Csf1r, Lgr5 and Olfm4 in the SI crypts of Csf1rf//fl;VillinCreERT2 mice after 4 weeks of tamoxifen exposure, followed by a 4 week chase in its absence is shown. Cell cycle related genes c-Myb, CyclinD1 and c-Myc expressions were slightly but significantly reduced (*p=0.05; Student t-test).

Conditional ablation of V体育平台登录 - Csf1r in vitro reduces organoid formation

To address the effect of directly deleting Csf1r in vitro rather than assessing ISC in crypts that had reached a steady-state in the global absence of CSF-1R we isolated SI crypts from Csf1rfl/fl;VillinCreERT2 mice and cultured these in the presence of 4-hydroxytamoxifen (4-OHT) during the process of organoid formation. We thus found that organoid formation was significantly impeded compared with the corresponding cultures of Csf1rfl/fl crypts (Figs. 5A–B). These data suggest that CSF-1R deletion in steady state SI crypts has a direct impact on ISC function independently of other cell types that support the ISC niche.

Figure 5.

Figure 5

Open in a new tab

Effect of in vitro deletion of Csf1r on organoid formation. (A) Organoid cultures were initiated from WT and Csf1rfl/fl;VillinCreERT2 mice and 4-hydroxytamoxifen (4OHT) added on day 1 and assessed on day 7. (B) The number of organoids formed from the same number of starting crypt nests Csf1rfl/fl:VillinCreERT2 and wild type (WT) cultures are shown (*p<0.05; Student t-test).

Discussion

The role of growth factor receptor signaling in the GI is complex but with the use of conditional KO constructs, the development of ISC reporter mice and the advent of in vitro culture techniques greater clarity about specific and direct roles has emerged. Our observations that the classic hematopoietic growth factor receptor, CSF-1R in its absentia had a profound effect on the SI proliferation, differentiation and ISC gene expression were previously conducted in global KO mice (Huynh et al., 2009). The core observation of this study was the loss of PC in Csf1r−/− and Csf1op/op mice and the subsequent transgenic rescue of PC and ISC activity in Csf1op/op mice by locally restricted transgenic expression of CSF-1 (Huynh et al., 2009). We argued that this concurrence of PC maturation and ISC activity was further evidence that PCs play a role in the ISC niche. Studies using different mouse mutants in the Clevers lab have led to the same viewpoint (Sato et al., 2011). Subsequently, the role of PC in ISC biology has been challenged where Atoh1/Math1 KO studies have resulted in the deletion of PC without any apparent consequence to ISC function or progenitor cell proliferation (Durand et al., 2012; Kim et al., 2012). The implications of Atoh1 on PC and ISC will be addressed later.

To directly address the CSF-1R data it is apparent that global and intestine specific KO studies show a clear loss of PC in the SI as measured by histology and the loss of lysozyme. Perhaps more compelling we show that CD24 is also lost. CD24 expression is both instructive and more encompassing as it marks both PC and ISC (Gracz et al., 2010; Sato et al., 2011; von Furstenberg et al., 2011). Although not exclusively a marker of ISC its location at the SI crypt base provides support to the view that it is employed within the ISC niche. Associated with CD24 loss is the reduced expression of non-PC genes that identify ISC, i.e., Bmi-1, Olfm-4 and Lgr-5. To independently and functionally test where the loss of CSF-1R is important to ISC we asked whether primary organoid forming capacity was compromised. This allowed us to uncouple the ISC from the Csf1r−/− niche support and in doing so it was evident that when CSF-1R was absent in ISC, and PC derived there from, their capacity to form organoids was markedly impaired.

The impact of deleting a gene globally and thus in the case of Csf1r during key point of development is genuinely different to tissue specific gene deletion in young fully developed mice. When we embarked upon deleting Csf1r using a tamoxifeninducible Cre restricted to the GI we were initially surprised that the phenotype was not similar to the global KO. However, with the proposition that the key role of CSF-1R in the SI is to support PC maturation, and further understanding that PCs have relatively long life spans compared to other SI epithelial cells, the basis of our observations was predicable as follows. Firstly, survival of mature/established PC is not CSF-1R-dependent. Secondly, if PCs have long life spans then it might be anticipated that several weeks may need to lapse before a phenotype is evident. The third prediction was that ISC gene expression signatures will be affected with the progressive PC loss due to the requirement of CSF-1R in PC replacement and maturation. The final realization based upon observations in other GI KO models is that when a gene is absolutely essential for crypt maintenance, escaper clones (Sato et al., 2011) that are not recombined will emerge to replace the void created by the deleted clones. Thus even with prolonged exposure of mice to tamoxifen of 4 weeks plus a further chase of 4 weeks substantive but incomplete PC ablation was a predictable outcome. Indeed similar observations have been made when comparing Sox9 GI-specific KO mice where deletion occurs early in development (Bastide et al., 2007; Mori-Akiyama et al., 2007) compared that seen in inducible KO in young mice (Sato et al., 2011).

Using the conditional deletion mice as sources of ISC we were able to show that just as the deletion of Csf1r from the beginning of their propagation (germline deletion) led to defective organoid formation so too was the case when Csf1r loss was induced at the initiation of their culture (conditional inducible deletion). These data speak to the intimate relationship between PC and ISC and their dependence on CSF-1R. This observation is interesting when comparison is made with the Atoh1 KO mice where induced loss of PC is perhaps compensated for by allowing ISC activity to continue in vivo, but not when tested in organoid culture (Durand et al., 2012). Thus, mice with global CSF-1R loss seem to have an incomplete compensation of PC loss for ISC activity (Huynh et al., 2009), indicating that CSF-1 expressed by stromal cells may be required for support of the ISC niche.

Notch signaling is without doubt essential to ISC function in the SI crypt (VanDussen et al., 2012). Notch-1 deletion leads to the expansion of all secretory lineages (Fre et al., 2005) however pharmacological inhibition of γ-secretase leads to disorganized lysozyme granule deposition (VanDussen et al., 2012) suggesting that the PCs are perhaps not normal in such treated mice. As Notch signaling favors ISC proliferation versus secretory cell differentiation via inhibition of Atoh1 (van Es et al., 2010) it is perhaps instructive that Atoh1 expression is elevated at the crypt bottom and that PC may still need Atoh1 for survival. It is also noteworthy that when propagated ex-vivo, Atoh1 null organoids did not grow which was argued may be due to the absence of some form of extra-epithelial stromal support (Durand et al., 2012). This implies that the loss of Atoh1 may lead to a change in the cytokine/growth factor milieu within the ISC niche that compensates for the loss of PC. Following on from this theme we showed that transgenic rescue of the PC and accompanied proliferative defects in the Csf1op/op mouse could be achieved by localized expression of a membrane-bound form or CSF-1 (Huynh et al., 2009).

As Olfm4 expression is reduced when Csf1r is deleted and that Olfm4 is a Notch target gene (VanDussen et al., 2012) implies that CSF-1R-dependent PCs are directly or indirectly impacting on Notch signaling as well. Although Olfm4 regulation is Notch-dependent, it is nevertheless Atoh1-independent (VanDussen et al., 2012) and this is evident when considering observations in Csf1r KO crypts that appear to have elevated Math1 and mucin production but reduced Math-1 antagonist Hes-1 as well as significantly reduced Olfm4. PC also serve as a source for Wnt3 among other factors (Sato et al., 2011) and in the absence of PC these might also be predicted to be in deficit leading to reduced Wnt signaling and targets thereof, such as Lgr5 and CyclinD1. Lgr5 expression is consistently down in SI crypts where Csf1r is deleted globally or when deleted solely in the SI epithelium. Therefore the removal of Atoh1 is unlikely to be functionally the same as the activation of Notch signaling even though some morphological phenocopying may be apparent. It is thus reasonable to argue that in the absence of Atoh1 there may be redirected Notch and/or even Wnt signaling to allow the ISC compartment to operate or compensate. To this end in the case of the Csf1r KO SI it is apparent that the overall expression of Hes-1 is substantially lower than in WT SI. As either Notch or Wnt signaling is capable of stimulating Hes-1 expression in the SI (Peignon et al., 2011) these data imply that both pathways are compromised in the Csf1r KO mouse. Furthermore, as Hes-1 expression is elevated to comparable levels in adenomas from mice with Apc mutant alone or Apc mutant plus activated Notch (Fre et al., 2009) it is however argued that Wnt and Notch activations are not additive in this setting with regard to this archetypical Notch target gene.

Additional studies will be required to investigate whether there is a relationship between CSF-1R and Notch signaling in the SI and why PCs appear to be dispensable when Atoh1 is deleted. In contrast to Atoh1, CSF-1R is not essential for PC survival, but rather their de novo formation. Other gene KOs leading to loss of PC differentiation further differ from Csfr1 KO and Atoh1 KO with respect to proliferation and secretory cell defects (Bastide et al., 2007; Shroyer et al., 2005), indicating that these genes may act at different stages of PC differentiation. While Atoh1 loss clearly abolishes terminally differentiated PC as demonstrated by the absence of granular structures CSF-1R loss also leads to proliferation defects, which might be explained by CSF-1R being necessary for the maintenance of proliferating PC progenitors. Indeed, proliferating cells can be found within the epithelial cell population expressing the PC marker lysozyme (von Furstenberg et al., 2011) and Csf1r−/− crypts retain some lysozyme expression while CRS4C, another PC marker, is completely lost (Huynh et al., 2009).

In the context of the above studies and several others PCs are not in all instances dispensable and here the data support an important role of PC in the integrity of the ISC niche. Specifically here the observations indicate a direct dependence of PC on CSF-1R signaling via locally presented CSF-1. Indeed defects in PC numeracy and morphology may serve as a sentinel for potential disruption of the ISC niche which may take time to manifest the ultimate consequences due to the long lived nature of PC. In line with this the onset of SI adenoma formation by Apc deletion in ISCs is characterized by an expansion of ISC-like and PC-like cells, which may represent expansion of a cancer stem cell niche (Schepers et al., 2012). Thus defects in the CSF-1R regulation of PC are likely to contribute to GI disease (Bevins and Salzman, 2011) that may reflect the important role PC play in innate immunity.

Supplementary Material

SuppMat

Acknowledgments

We thank Dr Silvia Fre for the helpful discussions. Expert microscopy assistance was provided by Dr Sarah Ellis and Mr Stephen Asquith (PMCC). Funding sources: ERS receives support from NIH #CA32551 and Einstein Cancer Center grant #5P30-CA13330. RGR and JM receive support from a NHMRC Program #487922 and Cancer Council of Victoria project grant #400217, Australia. MG is supported by a fellowship from the Swiss National Science Foundation #PBBEPS-139392.

Footnotes

✩

Author contributions: DA, DH, MG, SR, JRM, JWP, ERS, JM and RGR: conception and design of the study; DA, DH, SL, SR, JRM, JWP, ERS, JM and RGR: generation, collection, assembly, analysis and/or interpretation of data; DA, DH, MG, SR, JRM, JWP, ERS, JM and RGR: drafting or revision of the manuscript; DA, DH, MG, SL, SR, JRM, JWP, ERS, JM and RGR: approval of the final version of the manuscript.

The authors have no conflicts of interest.

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.scr.2012.12.001.

References

  1. Akazawa C, Ishibashi M, Shimizu C, Nakanishi S, Kageyama R. A mammalian helix–loop–helix factor structurally related to the product of Drosophila proneural gene atonal is a positive transcriptional regulator expressed in the developing nervous system. J. Biol. Chem. 1995;270:8730–8738. doi: 10.1074/jbc.270.15.8730. [DOI] [PubMed] [Google Scholar]
  2. Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, Cozijnsen M, Haegebarth A, Korving J, Begthel H, Peters PJ, Clevers H. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature. 2007;449:1003–1007. doi: 10.1038/nature06196. ["V体育安卓版" DOI] [PubMed] [Google Scholar]
  3. Bastide P, Darido C, Pannequin J, Kist R, Robine S, Marty-Double C, Bibeau F, Scherer G, Joubert D, Hollande F, et al. Sox9 regulates cell proliferation and is required for Paneth cell differentiation in the intestinal epithelium. J. Cell Biol. 2007;178:635–648. doi: 10.1083/jcb.200704152. [VSports在线直播 - DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bevins CL, Salzman NH. Paneth cells, antimicrobial peptides and maintenance of intestinal homeostasis. Nat. Rev. Microbiol. 2011;9:356–368. doi: 10.1038/nrmicro2546. [DOI] [PubMed] [Google Scholar]
  5. Chitu V, Stanley ER. Colony-stimulating factor-1 in immunity and inflammation. Curr. Opin. Immunol. 2006;18:39–48. doi: 10.1016/j.coi.2005.11.006. [V体育官网 - DOI] [PubMed] [Google Scholar]
  6. Dai XM, Ryan GR, Hapel AJ, Dominguez MG, Russell RG, Kapp S, Sylvestre V, Stanley ER. Targeted disruption of the mouse colony-stimulating factor 1 receptor gene results in osteopetrosis, mononuclear phagocyte deficiency, increased primitive progenitor cell frequencies, and reproductive defects. Blood. 2002;99:111–120. doi: 10.1182/blood.v99.1.111. [VSports注册入口 - DOI] [PubMed] [Google Scholar]
  7. Durand A, Donahue B, Peignon G, Letourneur F, Cagnard N, Slomianny C, Perret C, Shroyer NF, Romagnolo B. Functional intestinal stem cells after Paneth cell ablation induced by the loss of transcription factor Math1 (Atoh1) Proc. Natl. Acad. Sci. U. S. A. 2012;109:8965–8970. doi: 10.1073/pnas.1201652109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. el Marjou F, Janssen KP, Chang BH, Li M, Hindie V, Chan L, Louvard D, Chambon P, Metzger D, Robine S. Tissue-specific and inducible Cre-mediated recombination in the gut epithelium. Genesis. 2004;39:186–193. doi: 10.1002/gene.20042. [DOI] [PubMed] [Google Scholar]
  9. Fre S, Huyghe M, Mourikis P, Robine S, Louvard D, Artavanis-Tsakonas S. Notch signals control the fate of immature progenitor cells in the intestine. Nature. 2005;435:964–968. doi: 10.1038/nature03589. [DOI] [PubMed] [Google Scholar]
  10. Fre S, Pallavi SK, Huyghe M, Lae M, Janssen KP, Robine S, Artavanis-Tsakonas S, Louvard D. Notch and Wnt signals cooperatively control cell proliferation and tumorigenesis in the intestine. Proc. Natl. Acad. Sci. U. S. A. 2009;106:6309–6314. doi: 10.1073/pnas.0900427106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gracz AD, Ramalingam S, Magness ST. Sox9 expression marks a subset of CD24-expressing small intestine epithelial stem cells that form organoids in vitro. Am. J. Physiol. Gastrointest Liver Physiol. 2010;298:G590–G600. doi: 10.1152/ajpgi.00470.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Huynh D, Dai XM, Nandi S, Lightowler S, Trivett M, Chan CK, Bertoncello I, Ramsay RG, Stanley ER. Colony stimulating factor-1 dependence of Paneth cell development in the mouse small intestine. Gastroenterology. 2009;137:136–144. doi: 10.1053/j.gastro.2009.03.004. 144 e131-133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Ireland H, Houghton C, Howard L, Winton DJ. Cellular inheritance of a Cre-activated reporter gene to determine Paneth cell longevity in the murine small intestine. Dev. Dyn. 2005;233:1332–1336. doi: 10.1002/dvdy.20446. ["V体育ios版" DOI] [PubMed] [Google Scholar]
  14. Ishibashi M, Ang SL, Shiota K, Nakanishi S, Kageyama R, Guillemot F. Targeted disruption of mammalian hairy and enhancer of split homolog-1 (HES-1) leads to up-regulation of neural helix–loop–helix factors, premature neurogenesis, and severe neural tube defects. Genes Dev. 1995;9:3136–3148. doi: 10.1101/gad.9.24.3136. [DOI] [PubMed] [Google Scholar]
  15. Kim TH, Escudero S, Shivdasani RA. Intact function of Lgr5 receptor-expressing intestinal stem cells in the absence of Paneth cells. Proc. Natl. Acad. Sci. U. S. A. 2012;109:3932–3937. doi: 10.1073/pnas.1113890109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Li J, Chen K, Zhu L, Pollard JW. Conditional deletion of the colony stimulating factor-1 receptor (c-fms proto-oncogene) in mice. Genesis. 2006;44:328–335. doi: 10.1002/dvg.20219. ["V体育安卓版" DOI] [PubMed] [Google Scholar]
  17. Malaterre J, Carpinelli M, Ernst M, Alexander W, Cooke M, Sutton S, Dworkin S, Heath JK, Frampton J, McArthur G, et al. c-Myb is required for progenitor cell homeostasis in colonic crypts. Proc. Natl. Acad. Sci. U. S. A. 2007;104:3829–3834. doi: 10.1073/pnas.0610055104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Mori-Akiyama Y, van den Born M, van Es JH, Hamilton SR, Adams HP, Zhang J, Clevers H, de Crombrugghe B. SOX9 is required for the differentiation of Paneth cells in the intestinal epithelium. Gastroenterology. 2007;133:539–546. doi: 10.1053/j.gastro.2007.05.020. [DOI] [PubMed] [Google Scholar]
  19. Peignon G, Durand A, Cacheux W, Ayrault O, Terris B, Laurent-Puig P, Shroyer NF, Van Seuningen I, Honjo T, Perret C, Romagnolo B. Complex interplay between beta-catenin signalling and Notch effectors in intestinal tumor-igenesis. Gut. 2011;60:166–176. doi: 10.1136/gut.2009.204719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ramsay RG, Micallef S, Williams B, Mantamadiotis, Vincan ET, Heath J, Bertoncello I. Colony-stimulating factor 1 promotes clonogenic growth of normal murine colonic crypt epithelial cells in vitro. J. Interferon Cytokine Res. 2004;24:416–427. doi: 10.1089/1079990041535638. [DOI] [PubMed] [Google Scholar]
  21. Rizk P, Barker N. Gut stem cells in tissue renewal and disease: methods, markers, and myths. Wiley Interdiscip. Rev. Syst. Biol. Med. 2012;4:475–496. doi: 10.1002/wsbm.1176. [DOI] [PubMed] [Google Scholar]
  22. Sato T, Vries RG, Snippert HJ, van de Wetering M, Barker N, Stange DE, van Es JH, Abo A, Kujala P, Peters PJ, Clevers H. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 2009;459:262–265. doi: 10.1038/nature07935. [DOI] [PubMed] [Google Scholar]
  23. Sato T, van Es JH, Snippert HJ, Stange DE, Vries RG, van den Born M, Barker N, Shroyer NF, van de Wetering M, Clevers H. Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts. Nature. 2011;469:415–418. doi: 10.1038/nature09637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Schepers AG, Snippert HJ, Stange DE, van den Born M, van Es JH, van de Wetering M, Clevers H. Lineage tracing reveals Lgr5+ stem cell activity in mouse intestinal adenomas. Science. 2012;337:730–735. doi: 10.1126/science.1224676. [DOI] [PubMed] [Google Scholar]
  25. Shroyer NF, Wallis D, Venken KJ, Bellen HJ, Zoghbi HY. Gfi1 functions downstream of Math1 to control intestinal secretory cell subtype allocation and differentiation. Genes Dev. 2005;19:2412–2417. doi: 10.1101/gad.1353905. [DOI (VSports在线直播)] [PMC free article] [PubMed] [Google Scholar]
  26. van Es JH, de Geest N, van de Born M, Clevers H, Hassan BA. Intestinal stem cells lacking the Math1 tumour suppressor are refractory to Notch inhibitors. Nat. Commun. 2010;1:18. doi: 10.1038/ncomms1017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. VanDussen KL, Carulli AJ, Keeley TM, Patel SR, Puthoff BJ, Magness ST. Notch signaling modulates proliferation and differentiation of intestinal crypt base columnar stem cells. Development. 2012;139:488–497. doi: 10.1242/dev.070763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. von Furstenberg RJ, Gulati AS, Baxi A, Doherty JM, Stappenbeck TS, Gracz AD, Magness ST, Henning SJ. Sorting mouse jejunal epithelial cells with CD24 yields a population with characteristics of intestinal stem cells. Am. J. Physiol. Gastrointest. Liver Physiol. 2011;300:G409–G417. doi: 10.1152/ajpgi.00453.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

SuppMat
NIHMS580161-supplement-SuppMat.ppt (236KB, ppt)

VSports注册入口 - RESOURCES